PRGDB00067753 (Can.8625)

From PRG Wiki
Jump to: navigation, search
Can.8625
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 224689198 (GD095414)
Gene Class Unknown
Domain Type
Gene Species Capsicum annuum

Comment?

KS20023B06 KS20 Capsicum annuum cDNA, mRNA sequence

DNA Sequence

TATTCCATCAGTACCCTTGTCTATATCATCTTATCTTATCAGAAAAAAATTCTTGTTAGCTAGCATGCCATCAGTTTCCGGCCGAGTCGTCTGTGTTACCGGTGCCGGAGGCTTCATCGCCTCTTGGCTCGTTAAACTTCTTCTGGAAAAAGGCTACACTGTTAGAGGAACCGTAAGGAGTCCTGATGATCCAAAGAATAATCATTTGAGGGAACTTGATGGAGCAAAAGAGAGGCTGACTCTTTACAGAGGTGATCTTCTTGATTATCAGAGTTTGCGTGAAGCAATCAACGGCTGTGATGGAGTTTTCCACACGGCTTCACCAGTTACTGATGATCCAGAACAAATGGTGGAGCCAGCAGTTATTGGTACTAAAAATGTGATTACAGCAGCAGCTGAGGCTGAAGTAAGACGGGTTGTGTTCACTTCCTCAATTGGAGCTGTCTACATGGACCCAAACAGAGACCCTGAAAAAGTTGTCGACGAGACTTGCTGGAGTGATCCTGATTTCTGCAAGAACACTAAGAATTGGTATTGTTATGGAAAGATGGTGGCAGAACAAGCCGCGTGGGACGAGGCGAGGAACCAAGGTGTTGATTTGGTGGCAATCAATCCAGTGTTGGTGCTTGGACCATTGCTTCAAAATACTGTGAATGCTAGTGTTCTTCACGTCCTCAAGTACCTGACTGGG


Protein sequences

Name Description Sequence
Can.8625 translated coding region predicted by ESTScan from UniGene Can.8625

XIPSVPLSISSYLIRKKFLLASMPSVSGRVVCVTGAGGFIASWLVKLLLEKGYTVRGTVRSPDDPKNNHLRELDGAKERLTLYRGDLLDYQSLREAINGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAEVRRVVFTSSIGAVYMDPNRDPEKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEARNQGVDLVAINPVLVLGPLLQNTVNASVLHVLKYLTG

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR10366:SF9
13-231 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

LIRKKFLLASMPSVSGRVVCVTGAGGFIASWLVKLLLEKGYTVRGTVRSPDDPKNNHLRELDGAKERLTLYRGDLLDYQSLREAINGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAEVRRVVFTSSIGAVYMDPNRDPEKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEARNQGVDLVAINPVLVLGPLLQNTVNASVLHVLKYLTG

HMMPanther: PTHR10366
13-231 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

LIRKKFLLASMPSVSGRVVCVTGAGGFIASWLVKLLLEKGYTVRGTVRSPDDPKNNHLRELDGAKERLTLYRGDLLDYQSLREAINGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAEVRRVVFTSSIGAVYMDPNRDPEKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEARNQGVDLVAINPVLVLGPLLQNTVNASVLHVLKYLTG

superfamily: SSF51735
18-231 NAD(P)-binding Rossmann-fold domains

FLLASMPSVSGRVVCVTGAGGFIASWLVKLLLEKGYTVRGTVRSPDDPKNNHLRELDGAKERLTLYRGDLLDYQSLREAINGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAEVRRVVFTSSIGAVYMDPNRDPEKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEARNQGVDLVAINPVLVLGPLLQNTVNASVLHVLKYLTG

Gene3D: G3DSA:3.40.50.720
IPR016040
29-222 no description
NAD(P)-binding domain

RVVCVTGAGGFIASWLVKLLLEKGYTVRGTVRSPDDPKNNHLRELDGAKERLTLYRGDLLDYQSLREAINGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAEVRRVVFTSSIGAVYMDPNRDPEKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEARNQGVDLVAINPVLVLGPLLQNTVNASV

HMMPfam: PF01370
IPR001509
31-220 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGAGGFIASWLVKLLLEKGYTVRGTVRSPDDPKNNHLRELDGAKERLTLYRGDLLDYQSLREAINGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAEVRRVVFTSSIGAVYMDPNRDPEKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEARNQGVDLVAINPVLVLGPLLQNTVNA

Seg: seg
131-141 seg

AAAEAEVRRVV






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox