PRGDB00068449 (Ghi.8984)

From PRG Wiki
Jump to: navigation, search
Ghi.8984
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 73865911 (DT468649)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Gossypium hirsutum

Comment?

GH_CHX22D13.r GH_CHX Gossypium hirsutum cDNA clone GH_CHX22D13 3', mRNA sequence

DNA Sequence

GCGGCCCCCTTATAAGGTTTTTTTATCAAAACAAATGCTAAACTCATTACTTTTGCTGTTTCAAAGGAAAAACTACATATAGGTTTTTGGGAATCCATTGCTGCTTTCAACTGAATATACAAAGTCTTTCTTCTTACTAACTTCCTTTCTGTACTTGACATGTTCTAAAACATTAGAGATGAAAGTACCCTTTACGTGTTCGATCCATCCGAACTATTTTCTGCACTTTGTAGTCTTTTCTCCCTCCAACTCTCCCCCCACATCTTGGCCTCAGCCACCGCTCGTTCCCTGTTAAAATCCCGGTCTAACATCCTGGTTGTTTCCCTCGGAGACTCATTGTTCTCCGGCCCTTTCACACTGACCCTTTTAGCTTCATGTGCGCTATATGGATGGGATGTCAAATAATCAAGAGCAAGCACTATATCACCAATAGAGGGCCTGCAATTTGCATTTTCTTGGATGCATAGGAAGGCCACCTCTAGAGCTTTCTTCATGGTTGACTTGGAGAAGTGACCTCTCAGCAATGGATCCGCTAAGTTCAGAATGTTCATTCCATCTTTCAACATCGGTCGTGCCCAATCAACAAGGAATCGTTCTTCACGAGCACGGCTATCATCAAGAGCTTTACGTCCCGTTATCAGCTCCAATAAGACTACCCCAAAACTAAAGATGTCAGACTTCATAGTCAATTTTCCACTAGTGAGGTACTCAGGGGCACAGTAACCGTGGGTTCCCATGATCCTGGTGGAAACATGTGATTTATCTCCACTCGGACCGAACTTTGCAAGCCCGAAATCAGAGAGTTTTGGGTTGAATCCCTCACCTAATAGTATGTTAGATGACTTTAAATCTCTATATA


Protein sequences

Name Description Sequence
Ghi.8984 translated coding region predicted by ESTScan from UniGene Ghi.8984

XYRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDIVLALDYLTSHPYSAHEAKRVSVKGPENNESPRETTRMLDRDFNRERAVAEAKMWGESWREKRLQSAENSSDGSNT

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-160 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XYRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDIVLALDYLTSHPYS

Gene3D: G3DSA:1.10.510.10
2-148 no description

YRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDIV

HMMPanther: PTHR24420:SF700
2-222 SUBFAMILY NOT NAMED

YRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDIVLALDYLTSHPYSAHEAKRVSVKGPENNESPRETTRMLDRDFNRERAVAEAKMWGESWREKRLQSAENSSDGSNT

HMMPanther: PTHR24420
2-222 FAMILY NOT NAMED,FAMILY NOT NAMED

YRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDIVLALDYLTSHPYSAHEAKRVSVKGPENNESPRETTRMLDRDFNRERAVAEAKMWGESWREKRLQSAENSSDGSNT

superfamily: SSF56112
IPR011009
2-151 Protein kinase-like (PK-like)
Protein kinase-like domain

YRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDIVLAL

HMMPfam: PF00069
IPR017442
2-147 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

YRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDI

HMMSmart: SM00220
IPR002290
2-154 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

YRDLKSSNILLGEGFNPKLSDFGLAKFGPSGDKSHVSTRIMGTHGYCAPEYLTSGKLTMKSDIFSFGVVLLELITGRKALDDSRAREERFLVDWARPMLKDGMNILNLADPLLRGHFSKSTMKKALEVAFLCIQENANCRPSIGDIVLALDYL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox