PRGDB00070329 (Lja.15822)

From PRG Wiki
Jump to: navigation, search
Lja.15822
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 293522996 (FS336755)
Gene Class Unknown
Domain Type
Gene Species Lotus japonicus

Comment?

FS336755 LjFL3 Lotus japonicus cDNA clone LjFL3-057-AC08 5', mRNA sequence

DNA Sequence

GTCTTTCTTCCCCCTGCCAAGTACCAAACAAGTCACTGAGGATTCTCTCTTATCAAAGGTGGTGTTTTGTTGCCTGGGAAAGTTAAAAAACTGCTTGAATTCAAAGAGGTTGAAATTCTAAGCAGGGGAAGATGGACAATGCACCCGGACGACACCATCTGTTTGTTCCAGGGCCTACGAACATCCCTGAACAAGTGATTCGGGCTATGAACCGAAACAATGAGGACTACCGTGCTCCAGCAATACCAGCACTGACAAAAACTCTGCTTGAAGATGTGAAGAAGATTTTCAAGACTAGCACTGGAATCCCATTTCTTTTCCCCACAACTGGCACTGGTGCATGGGAGAGTGCACTGACAAATACCTTATCTCCTGGGGATCGTATTGTATCTTTCCTGATTGGCCAATTCAGCTTGCTTTGGATTGACCAGCAGCAACGCCTCAACTTCAATGTTGATGTTGTGGAAAGTGATTGGGGCCAGGGTGCCAATCTTGATGTTCTGGAATCAAAACTTGCTTCAGATAGAACACACACCATAAAGGCTATTTGCATTGCTCACAATGAGACTGCAACCGGGGTCACCAATAACTTGGCCAAAGTGAGAAAAATTCTCGATGACTACCAGCATCCAGCCCTTCTTATTGTGGATGGAGTGTCTTCCATTTGTGCTCTCGATTTCCGCATGGATGAATGGGGAGTGGATGTGGCCGTGACTGGCTCCCAGAAAGCTCTTTCCCTTCCCACTGGGTTAGGCATTGTCTGTGCAGGTCCTAAAGCCATTGAGGCTTCAAAATCTGCCAAATCACTC


Protein sequences

Name Description Sequence
Lja.15822 translated coding region predicted by ESTScan from UniGene Lja.15822

MDNAPGRHHLFVPGPTNIPEQVIRAMNRNNEDYRAPAIPALTKTLLEDVKKIFKTSTGIPFLFPTTGTGAWESALTNTLSPGDRIVSFLIGQFSLLWIDQQQRLNFNVDVVESDWGQGANLDVLESKLASDRTHTIKAICIAHNETATGVTNNLAKVRKILDDYQHPALLIVDGVSSICALDFRMDEWGVDVAVTGSQKALSLPTGLGIVCAGPKAIEASKSAKSL

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR21152:SF7
1-226 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

MDNAPGRHHLFVPGPTNIPEQVIRAMNRNNEDYRAPAIPALTKTLLEDVKKIFKTSTGIPFLFPTTGTGAWESALTNTLSPGDRIVSFLIGQFSLLWIDQQQRLNFNVDVVESDWGQGANLDVLESKLASDRTHTIKAICIAHNETATGVTNNLAKVRKILDDYQHPALLIVDGVSSICALDFRMDEWGVDVAVTGSQKALSLPTGLGIVCAGPKAIEASKSAKSL

HMMPanther: PTHR21152
1-226 FAMILY NOT NAMED,AMINOTRANSFERASE CLASS V

MDNAPGRHHLFVPGPTNIPEQVIRAMNRNNEDYRAPAIPALTKTLLEDVKKIFKTSTGIPFLFPTTGTGAWESALTNTLSPGDRIVSFLIGQFSLLWIDQQQRLNFNVDVVESDWGQGANLDVLESKLASDRTHTIKAICIAHNETATGVTNNLAKVRKILDDYQHPALLIVDGVSSICALDFRMDEWGVDVAVTGSQKALSLPTGLGIVCAGPKAIEASKSAKSL

superfamily: SSF53383
IPR015424
5-224 PLP-dependent transferases
Pyridoxal phosphate-dependent transferase, major d

PGRHHLFVPGPTNIPEQVIRAMNRNNEDYRAPAIPALTKTLLEDVKKIFKTSTGIPFLFPTTGTGAWESALTNTLSPGDRIVSFLIGQFSLLWIDQQQRLNFNVDVVESDWGQGANLDVLESKLASDRTHTIKAICIAHNETATGVTNNLAKVRKILDDYQHPALLIVDGVSSICALDFRMDEWGVDVAVTGSQKALSLPTGLGIVCAGPKAIEASKSAK

HMMPfam: PF00266
IPR000192
10-221 Aminotran_5
Aminotransferase, class V/Cysteine desulfurase

LFVPGPTNIPEQVIRAMNRNNEDYRAPAIPALTKTLLEDVKKIFKTSTGIPFLFPTTGTGAWESALTNTLSPGDRIVSFLIGQFSLLWIDQQQRLNFNVDVVESDWGQGANLDVLESKLASDRTHTIKAICIAHNETATGVTNNLAKVRKILDDYQHPALLIVDGVSSICALDFRMDEWGVDVAVTGSQKALSLPTGLGIVCAGPKAIEASK

Gene3D: G3DSA:3.40.640.10
IPR015421
19-223 no description
Pyridoxal phosphate-dependent transferase, major r

PEQVIRAMNRNNEDYRAPAIPALTKTLLEDVKKIFKTSTGIPFLFPTTGTGAWESALTNTLSPGDRIVSFLIGQFSLLWIDQQQRLNFNVDVVESDWGQGANLDVLESKLASDRTHTIKAICIAHNETATGVTNNLAKVRKILDDYQHPALLIVDGVSSICALDFRMDEWGVDVAVTGSQKALSLPTGLGIVCAGPKAIEASKSA

PatternScan: PS00595
IPR020578
190-210 AA_TRANSFER_CLASS_5
Aminotransferase class-V pyridoxal-phosphate bindi

VDVAVTGSQKALSLPTGLGIV






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox