PRGDB00071017 (Mdo.24186)

From PRG Wiki
Jump to: navigation, search
Mdo.24186
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 226753791 (GO509514)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Malus x domestica

Comment?

NP_180274.1| leucine-rich repeat transmembrane protein kinase, putative [Arabidopsis thaliana] pir|C84668 probable receptor-like protein kinase [imported] - Arabidopsis thaliana g>

DNA Sequence

ATATCGAATTCCGTTGCTGTCGAGCAAAAGGAAGGAAAGAATTTGCAAGAGAAGTGAAGAAACTAGGAAACATCAGGCACCCAAATCTAGTTTCTCTGCTGGGTTATTACTGGGGCCCTATAGAACATGAGAAACTGATTATATCAACTTATATCAATGCACAATCATTGGCATTCCATCTCCATGAGGCAGAGCGAACAAAACTCTCTCCCCTGTCACTTGAGGAACGGCTTAGGATTTCTGTAGATGTTGCCCGATGTCTGAACTTCCTGCATAATGAGAAGGCAATTCCCCATGGCAACCTCAAATCCACGAATATTTTATTAGAAACTCCTAGTCTGAATGCACTCCTTACAGATTATAGTCTCCACCGAATTTTGACTCCCGCTGGGACTACTGAGCAAGTCTTGAATGCAGGTGCTCTTGGCTATCGCCCCCCTGAATTTGCTAGCTCAAGTAAACCCTGCCCATCGTTGAAAAGTGATGTCTATGCATTTGGGGTGATCTTGTTGGAGCTCCTGACTGGAAAGAGTTCCGGGGAGATTGTCTCTGGGATACCGGGTGTGGTTGATCTGACAGACTGGGTGA


Protein sequences

Name Description Sequence
Mdo.24186 translated coding region predicted by ESTScan from UniGene Mdo.24186

XIEFRCCRAKGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGKSSGEIVSGIPGVVDLTDWVX

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-197 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XIEFRCCRAKGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGKSSGEIVSGIPGVVDLTDWVX

HMMSmart: SM00219
IPR020635
2-196 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

IEFRCCRAKGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGKSSGEIVSGIPGVVDLTDWV

HMMSmart: SM00220
IPR002290
5-196 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

RCCRAKGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGKSSGEIVSGIPGVVDLTDWV

HMMPanther: PTHR24420:SF466
9-196 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

AKGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGKSSGEIVSGIPGVVDLTDWV

HMMPanther: PTHR24420
9-196 FAMILY NOT NAMED,FAMILY NOT NAMED

AKGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGKSSGEIVSGIPGVVDLTDWV

HMMPfam: PF07714
IPR001245
10-177 Pkinase_Tyr
Serine-threonine/tyrosine-protein kinase

KGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGK

superfamily: SSF56112
IPR011009
10-177 Protein kinase-like (PK-like)
Protein kinase-like domain

KGRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGK

Gene3D: G3DSA:1.10.510.10
11-178 no description

GRKEFAREVKKLGNIRHPNLVSLLGYYWGPIEHEKLIISTYINAQSLAFHLHEAERTKLSPLSLEERLRISVDVARCLNFLHNEKAIPHGNLKSTNILLETPSLNALLTDYSLHRILTPAGTTEQVLNAGALGYRPPEFASSSKPCPSLKSDVYAFGVILLELLTGKS






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox