PRGDB00071019 (Mdo.24273)

From PRG Wiki
Jump to: navigation, search
Mdo.24273
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 226765937 (GO521853)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Malus x domestica

Comment?

NP_566341.1| protein kinase family [Arabidopsis thaliana] gb|AAM61567.1| putative receptor ser thr protein kinase [Arabidopsis thaliana], mRNA sequence

DNA Sequence

CACGAGGGGATTGGGAAAAAAGATCAGCCATTTGCTTGGGTACTGCCAGGGGTCTTACGTATCTTCATGAAGAACTGGTGCCACATATTGTACATAGAGATATCAAGGCTAGTAATTTACTTTTAGACAGAGAATTTAACCCGAAAATAGGAGACTTTGGGTTGGCTAAACTCTTCCCTGATGATATCACTCATATCAGCACAAGGATTGCGGGCACAACTGGTTATTTGGCACCAGAATATGCATTGGGAGGTCAGTTAACCCTCAAGGCCGATGTTTACAGTTTTGGGGTTCTCGTTCTTGAAATAGTATGTGGAAGAAGCAGTGCCAAGGGAGACTGGGGTGGGGCAGAAAAGTTTCTGCTTGAATGGGCATGGCAGCTCCATGAAGAAGGGAGACTATTGGAGCTAGCTGACCCGGAGATGGGGGAATTTCCGGAGGAAGAAGTCCTTAGGTACATGAAGGTAGCATTTTTCTGCACCCAAGCAGCAGCAAACCGAAGACCAAAGATGAGCCAGGTTCTTGACATGCTCTCGAGAAACATAAGACTCAACGAGAAACAACTTACAGCCCCAGGTTTCTTCAACAGTTCAGGGAGCCTGAGCGGACCTTCAGGTAAAAAGTCATTTTCCGAAACCACTACCAGTCAGATGAGTTCCGTCCCCGACACTAT


Protein sequences

Name Description Sequence
Mdo.24273 translated coding region predicted by ESTScan from UniGene Mdo.24273

XRGDWEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDMLSRNIRLNEKQLTAPGFFNSSGSLSGPSGKKSFSETTTSQMSSVPDTX

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-184 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XRGDWEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDMLSRNIRL

HMMSmart: SM00219
IPR020635
3-178 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

GDWEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDML

superfamily: SSF56112
IPR011009
4-178 Protein kinase-like (PK-like)
Protein kinase-like domain

DWEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDML

Gene3D: G3DSA:1.10.510.10
4-212 no description

DWEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDMLSRNIRLNEKQLTAPGFFNSSGSLSGPSGKKSFSE

HMMPanther: PTHR24420:SF679
4-194 SUBFAMILY NOT NAMED

DWEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDMLSRNIRLNEKQLTAPGF

HMMPanther: PTHR24420
4-194 FAMILY NOT NAMED,FAMILY NOT NAMED

DWEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDMLSRNIRLNEKQLTAPGF

HMMPfam: PF00069
IPR017442
5-113 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

WEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGD

HMMSmart: SM00220
IPR002290
5-178 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

WEKRSAICLGTARGLTYLHEELVPHIVHRDIKASNLLLDREFNPKIGDFGLAKLFPDDITHISTRIAGTTGYLAPEYALGGQLTLKADVYSFGVLVLEIVCGRSSAKGDWGGAEKFLLEWAWQLHEEGRLLELADPEMGEFPEEEVLRYMKVAFFCTQAAANRRPKMSQVLDML

PatternScan: PS00108
IPR008271
30-42 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IVHRDIKASNLLL

Seg: seg
192-211 seg

PGFFNSSGSLSGPSGKKSFS






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox