PRGDB00071027 (Mdo.24944)

From PRG Wiki
Jump to: navigation, search
Mdo.24944
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 91045818 (EB156236)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Malus x domestica

Comment?

030123ABLC004395HT (ABLC) Braeburn cell culture three days after subculture Malus x domestica cDNA clone ABLC004395, mRNA sequence

DNA Sequence

ACGAATATTCTCCTTGACAACTTCTTCTGTGTCAAGGTAGCAGATTTTGGACTATCTCGCCTCTTCCCCATGAACGTCACGCACATCTCAACTGCTCCACAAGGGACTCCAGGTTATGTTGATCCCGAGTATAACGAATGCTACCAGCTTACGAGTAAGAGTGATGTCTATAGCTTTGGTGTGGTGCTGATTGAGCTCATATCATCCATGCCAGCCGTTGACATCACGAGGCATCGACACGAGATCAATTTGTCTACCATGGCAATCAACAAGATTCAAAAACAAACATTACATGAGCTAGTAGACCCATACTTAGGGTTTGAATCAGACTCCAGAACACGAAAAATGATCATTGCTGTGGCCGAACTAGCATTTCGCTGTCTGAATAGTGACAAGGACTTGAGACCTTCCATGATTGAGGTGCTTAACGAACTAAAGCGTATACAGAGCGATGATTTTGACATACAAAAAGCAGAGGAGATTGATATTTCAGCAATCGATATTGTGCCGTTAAAGAGTGATCCGCTGCCTGCTTCACCAGATTCCGTGGCATTCAAATGGACTAGCGTGTCTACGACACCAAATGCCAGCGGCTAAGTAAACTTTATAGTTCTCGTCCATAAGTCGTGGCTGTCATGTTGTATTCGTCTACCGGATTTGTGATTTGTTGAAT


Protein sequences

Name Description Sequence
Mdo.24944 translated coding region predicted by ESTScan from UniGene Mdo.24944

TNILLDNFFCVKVADFGLSRLFPMNVTHISTAPQGTPGYVDPEYNECYQLTSKSDVYSFGVVLIELISSMPAVDITRHRHEINLSTMAINKIQKQTLHELVDPYLGFESDSRTRKMIIAVAELAFRCLNSDKDLRPSMIEVLNELKRIQSDDFDIQKAEEIDISAIDIVPLKSDPLPASPDSVAFKWTSVSTTPNASG

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR24420:SF426
1-197 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

TNILLDNFFCVKVADFGLSRLFPMNVTHISTAPQGTPGYVDPEYNECYQLTSKSDVYSFGVVLIELISSMPAVDITRHRHEINLSTMAINKIQKQTLHELVDPYLGFESDSRTRKMIIAVAELAFRCLNSDKDLRPSMIEVLNELKRIQSDDFDIQKAEEIDISAIDIVPLKSDPLPASPDSVAFKWTSVSTTPNAS

HMMPanther: PTHR24420
1-197 FAMILY NOT NAMED,FAMILY NOT NAMED

TNILLDNFFCVKVADFGLSRLFPMNVTHISTAPQGTPGYVDPEYNECYQLTSKSDVYSFGVVLIELISSMPAVDITRHRHEINLSTMAINKIQKQTLHELVDPYLGFESDSRTRKMIIAVAELAFRCLNSDKDLRPSMIEVLNELKRIQSDDFDIQKAEEIDISAIDIVPLKSDPLPASPDSVAFKWTSVSTTPNAS

ProfileScan: PS50011
IPR000719
1-148 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

TNILLDNFFCVKVADFGLSRLFPMNVTHISTAPQGTPGYVDPEYNECYQLTSKSDVYSFGVVLIELISSMPAVDITRHRHEINLSTMAINKIQKQTLHELVDPYLGFESDSRTRKMIIAVAELAFRCLNSDKDLRPSMIEVLNELKRI

HMMPfam: PF00069
IPR017442
2-143 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

NILLDNFFCVKVADFGLSRLFPMNVTHISTAPQGTPGYVDPEYNECYQLTSKSDVYSFGVVLIELISSMPAVDITRHRHEINLSTMAINKIQKQTLHELVDPYLGFESDSRTRKMIIAVAELAFRCLNSDKDLRPSMIEVLN

Gene3D: G3DSA:1.10.510.10
2-153 no description

NILLDNFFCVKVADFGLSRLFPMNVTHISTAPQGTPGYVDPEYNECYQLTSKSDVYSFGVVLIELISSMPAVDITRHRHEINLSTMAINKIQKQTLHELVDPYLGFESDSRTRKMIIAVAELAFRCLNSDKDLRPSMIEVLNELKRIQSDDF

superfamily: SSF56112
IPR011009
2-145 Protein kinase-like (PK-like)
Protein kinase-like domain

NILLDNFFCVKVADFGLSRLFPMNVTHISTAPQGTPGYVDPEYNECYQLTSKSDVYSFGVVLIELISSMPAVDITRHRHEINLSTMAINKIQKQTLHELVDPYLGFESDSRTRKMIIAVAELAFRCLNSDKDLRPSMIEVLNEL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox