PRGDB00071141 (Mtr.526)

From PRG Wiki
Jump to: navigation, search
Mtr.526
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 11898960 (BF634802)
Gene Class Unknown
Domain Type
Gene Species Medicago truncatula

Comment?

NF070C12DT1F1097 Drought Medicago truncatula cDNA clone NF070C12DT 5', mRNA sequence

DNA Sequence

GCCATAAGATTTCTGTACTCAACCTCCGTAGCTGTTTTGCTTGGAACCATGTTTTGGAACCTTGGCTCCAATATTGAAAAGGAACAAGATCTTTTTAATGCCATGGGGTCCATGTATTCAGCCGTTCTCCTAATTGGCATCAAGAATAGTAATGCNTGTGCAGCCAGTGGTAGCTGTTGAAAGAACGGTCTTTTATCGAGAAAGAGCAGCCGGAATGTATTCAGCTTTTCCATATGCTTTTGCTCAGGTTGTAATTGAGCTTCCACATGTTTTTGTACAATCTGTGGTCTATGGATTTATAGTTTATGCTATGATTGGTTTTGAGTGGTCTGTGGTTAAAGTTTTGTGGTACCTGTTCTTCATGTATTTCACCTTCCTCTATTTTACCTTCTATGGTATGATGGCAGTGGCCATGACCCCAAACAACCACATTTCAACTATAGTTTCCTCTGCTTTCTATTCAGTATGGAATCTCTTCTCAGGATTCATAGTTCCAAGACCTAGAATTCCAGTGTGGTGGAGGTGGTACAGTTGGGCCAATCCAGTGGCTTGGAGTTTGTATGGATTGGTGGCTTCACAATATGGAGATTTAAAACAAAACATTGAAACCAGTGATAGAAGCCAAACAGTGAAAGATTTTCTGAGAAATTACTTTGGTTTCAAGCATGATTTTCTAGGAA


Protein sequences

Name Description Sequence
Mtr.526 translated coding region predicted by ESTScan from UniGene Mtr.526

AIRFLYSTSVAVLLGTMFWNLGSNIEKEQDLFNAMGSMYSAVLLIGIKNSNACAASGAVERTVFYRERAAGMYSAFPYAFAQVVIELPHVFVQSVVYGFIVYAMIGFEWSVVKVLWYLFFMYFTFLYFTFYGMMAVAMTPNNHISTIVSSAFYSVWNLFSGFIVPRPRIPVWWRWYSWANPVAWSLYGLVASQYGDLKQNIETSDRSQTVKDFLRNYFGFKHDFLGX


Domains

Domain Start-End Description Sequence

HMMPanther: PTHR19241:SF10
1-226 ATP-BINDING CASSETTE TRANSPORTER (PDR),ATP-BINDING CASSETTE TRANSPORTER (PDR)

AIRFLYSTSVAVLLGTMFWNLGSNIEKEQDLFNAMGSMYSAVLLIGIKNSNACAASGAVERTVFYRERAAGMYSAFPYAFAQVVIELPHVFVQSVVYGFIVYAMIGFEWSVVKVLWYLFFMYFTFLYFTFYGMMAVAMTPNNHISTIVSSAFYSVWNLFSGFIVPRPRIPVWWRWYSWANPVAWSLYGLVASQYGDLKQNIETSDRSQTVKDFLRNYFGFKHDFLG

HMMPanther: PTHR19241
1-226 FAMILY NOT NAMED,ATP-BINDING CASSETTE TRANSPORTER

AIRFLYSTSVAVLLGTMFWNLGSNIEKEQDLFNAMGSMYSAVLLIGIKNSNACAASGAVERTVFYRERAAGMYSAFPYAFAQVVIELPHVFVQSVVYGFIVYAMIGFEWSVVKVLWYLFFMYFTFLYFTFYGMMAVAMTPNNHISTIVSSAFYSVWNLFSGFIVPRPRIPVWWRWYSWANPVAWSLYGLVASQYGDLKQNIETSDRSQTVKDFLRNYFGFKHDFLG

HMMPfam: PF01061
IPR013525
3-194 ABC2_membrane
ABC-2 type transporter

RFLYSTSVAVLLGTMFWNLGSNIEKEQDLFNAMGSMYSAVLLIGIKNSNACAASGAVERTVFYRERAAGMYSAFPYAFAQVVIELPHVFVQSVVYGFIVYAMIGFEWSVVKVLWYLFFMYFTFLYFTFYGMMAVAMTPNNHISTIVSSAFYSVWNLFSGFIVPRPRIPVWWRWYSWANPVAWSLYGLVASQY

Seg: seg
117-131 seg

YLFFMYFTFLYFTFY






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox