PRGDB00071276 (Mtr.10054)

From PRG Wiki
Jump to: navigation, search
Mtr.10054
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 7718470 (AW774553)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Medicago truncatula

Comment?

EST333704 KV3 Medicago truncatula cDNA clone pKV3-22P6, mRNA sequence

DNA Sequence

TTTATATGACTACCTACCTGGCGGTAGTCTTGATGAAGTTCTTCATGAAAAATCTGAGCAACTAGACTGGGATTCACGGTTGAATATAATCATGGGAGCTGCAAAAGGGCTTGCTTACTTGCACCACGATTGTTCCCCTAGGATCATACACCGTGACATTAAATCGAGCAACATTTTGCTTGATGGAAAATTGGATGCTAGAGTTTCTGATTTTGGACTTGCCAAACTTCTGGAGGATGAAGAATCTCACATCACCACTATTGTTGCCGGAACATTTGGTTATCTAGCTCCAGAGTATATGCAAAGTGGAAGAGCAACTGAGAAGACCGATGTTTATAGTTTTGGGGTGTTGACACTTGAAGTGCTTAGTGGAAAGCGGCCAACAGATGCATCCTTCATTGAAAAGGGTCTAAATGTTGTTGGTTGGTTGAATTTCCTTATTACTGAAAATAGGCCAAGGGAAATTGTCGATCCACTATGCGACGGGGTGCAGGTGGAGAGCCTTGATGCCTTGCTCTCGATGGCTATTCAGTGTGTTTCCTCAAATCCAGAGGATCGACCCACTATGCACCGAGTGGTCCAGTTGCTTGAATCGGAGGTAGTAAACTCCATGCCCAAGTGACTTC


Protein sequences

Name Description Sequence
Mtr.10054 translated coding region predicted by ESTScan from UniGene Mtr.10054

XLYDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLLESEVVNSMPKXLX

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-202 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XLYDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLLESEVV

HMMSmart: SM00219
IPR020635
1-197 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

XLYDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLL

superfamily: SSF56112
IPR011009
2-197 Protein kinase-like (PK-like)
Protein kinase-like domain

LYDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLL

HMMPanther: PTHR24420:SF479
2-206 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

LYDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLLESEVVNSMP

HMMPanther: PTHR24420
2-206 FAMILY NOT NAMED,FAMILY NOT NAMED

LYDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLLESEVVNSMP

HMMSmart: SM00220
IPR002290
2-202 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

LYDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLLESEVV

HMMPfam: PF00069
IPR017442
3-195 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

YDYLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQ

Gene3D: G3DSA:1.10.510.10
5-199 no description

YLPGGSLDEVLHEKSEQLDWDSRLNIIMGAAKGLAYLHHDCSPRIIHRDIKSSNILLDGKLDARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLTLEVLSGKRPTDASFIEKGLNVVGWLNFLITENRPREIVDPLCDGVQVESLDALLSMAIQCVSSNPEDRPTMHRVVQLLES

PatternScan: PS00108
IPR008271
49-61 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IIHRDIKSSNILL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox