PRGDB00071588 (Nta.6821)

From PRG Wiki
Jump to: navigation, search
Nta.6821
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 83417474 (DV999468)
Gene Class Unknown
Domain Type
Gene Species Nicotiana tabacum

Comment?

KL4B.103B18F.051103T7 KL4B Nicotiana tabacum cDNA clone KL4B.103B18, mRNA sequence

DNA Sequence

TATAAACTTCCAAAGAAGCGAGCCTATTTCTTCCTTCTATATCCACTCATCCTCGTCTTATATCATCTTCATCATCGTCTACCTAAACCTGAGCTCAACGGAAAAGTAATTACCATGCCGTCAGTTTCCGGCCAAATCGTTTGTGTTACTGGCGCCGGAGGTTTCATTGCCTCTTGGCTCGTTAAAATTCTTCTGGAAAAAGGTTACACTGTTAGAGGAACAGTACGGAATCCAGATGATCCCAAAAATAGTCATTTGAGGGAGCTTGAAGGAGCAAAAGAGAGGCTGACTCTGTGCAGAGCTGATCTTCTTGATTTCCAGAGTTTGCGAGAAGCAATCAGCGGCTGTGACGGAGTGTTCCACACAGCTTCGCCTGTCACTGATGATCCAGAACAAATGGTGGAGCCAGCAGTTATTGGTACTAAGAATGTGATAACGGCAGCAGCAGAGGCCAACGTGCGACGTGTGGTGTTCACTTCCTCAATTGGTGCTGTGTACATGGACCCAAACAGGGACCCTGATAAGGTTGTCGACGAGACATGTTGGAGTGATCCTGATTTCTGCAAAAACACCAAGAATTGGTATTGCTATGGAAAGATGGTGGCAGAACAAGCAGCATGGGACGAGGCAAGGGAGAAAGGAGTCGATTTGGTGGCAATCAACCCAGTGTTGGTGCTTGGACCACTGCTCCAACAGAATGTGAATGCCAGTGTTCTTCACATCCACAAGTACCTCACTGGCTCTGCTAAAACATATGCCAATTCAGTTCAGGCATATATACATGTTAGGGATGTGGCTTTAGCTCACATACTTCTCTACGAGACACCTTCTGCATCTGGCCGTTATCTCTGTGCCGAAAGTGTGCTGCACCGCGGCGACGTGGTTGAAATTCTGGCCAAATTCTTCCCGGAGTATCCTAT


Protein sequences

Name Description Sequence
Nta.6821 translated coding region predicted by ESTScan from UniGene Nta.6821

YKLPKKRAYFFLLYPLILVLYHLHHRLPKPELNGKVITMPSVSGQIVCVTGAGGFIASWLVKILLEKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDFQSLREAISGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEANVRRVVFTSSIGAVYMDPNRDPDKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEAREKGVDLVAINPVLVLGPLLQQNVNASVLHIHKYLTGSAKTYANSVQAYIHVRDVALAHILLYETPSASGRYLCAESVLHRGDVVEILAKFFPEYPX

Domains

Domain Start-End Description Sequence

Seg: seg
9-25 seg

YFFLLYPLILVLYHLHH

HMMPanther: PTHR10366:SF9
29-306 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

KPELNGKVITMPSVSGQIVCVTGAGGFIASWLVKILLEKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDFQSLREAISGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEANVRRVVFTSSIGAVYMDPNRDPDKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEAREKGVDLVAINPVLVLGPLLQQNVNASVLHIHKYLTGSAKTYANSVQAYIHVRDVALAHILLYETPSASGRYLCAESVLHRGDVVEILAKFFPEYP

HMMPanther: PTHR10366
29-306 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

KPELNGKVITMPSVSGQIVCVTGAGGFIASWLVKILLEKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDFQSLREAISGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEANVRRVVFTSSIGAVYMDPNRDPDKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEAREKGVDLVAINPVLVLGPLLQQNVNASVLHIHKYLTGSAKTYANSVQAYIHVRDVALAHILLYETPSASGRYLCAESVLHRGDVVEILAKFFPEYP

superfamily: SSF51735
34-303 NAD(P)-binding Rossmann-fold domains

GKVITMPSVSGQIVCVTGAGGFIASWLVKILLEKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDFQSLREAISGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEANVRRVVFTSSIGAVYMDPNRDPDKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEAREKGVDLVAINPVLVLGPLLQQNVNASVLHIHKYLTGSAKTYANSVQAYIHVRDVALAHILLYETPSASGRYLCAESVLHRGDVVEILAKFFP

Gene3D: G3DSA:3.40.50.720
IPR016040
44-303 no description
NAD(P)-binding domain

GQIVCVTGAGGFIASWLVKILLEKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDFQSLREAISGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEANVRRVVFTSSIGAVYMDPNRDPDKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEAREKGVDLVAINPVLVLGPLLQQNVNASVLHIHKYLTGSAKTYANSVQAYIHVRDVALAHILLYETPSASGRYLCAESVLHRGDVVEILAKFFP

HMMPfam: PF01370
IPR001509
47-283 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGAGGFIASWLVKILLEKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDFQSLREAISGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEANVRRVVFTSSIGAVYMDPNRDPDKVVDETCWSDPDFCKNTKNWYCYGKMVAEQAAWDEAREKGVDLVAINPVLVLGPLLQQNVNASVLHIHKYLTGSAKTYANSVQAYIHVRDVALAHILLYETPSASGRYL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox