PRGDB00071621 (Nta.9987)

From PRG Wiki
Jump to: navigation, search
Nta.9987
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 56544479 (AY775046)
Gene Class RLK
Domain Type Ser-Thr Kinase, Receptor-Like Kinase
Gene Species Nicotiana tabacum

Comment?

Nicotiana tabacum Avr9

DNA Sequence

GGGTGCTTTCGGCATAGTTTATAAAGGAGAGTTGTCATCTTCTAATTCAAGAACAGTTGTAGCTGTCAAGAAACTAGACAAGCTAGCAAATGATGGTGAGAACGAATTCAAAACAGAAGCCAGTGTAATAGCCAGGACTCATCACAAGAATCTGGTGAGATTGGTTGGATTCTGTGATGAAGGACCAGAAAAGAAGCTTTTGGTCTATGAGTTTATGAGCCATGGCTCCTTGGCAGACTTCCTTTTCAGTCAGTCAAGGCAACAATGGAACAAAAGAATCAGAATTGCATATGGGGTTGCAAGAGGAATCTCGTATTTGCACGAGGAGTGCAGCACACAGATCATCCATTGCGATATAAAGCCTCAAAACATCCTGCTGGATGATTCATTTGAAGCAAGGATCTCTGATTTCGGATTGGCAAAACTTTTGATGAAGGGTCAAACTCGGACACTAACGGGGATTAGAGGGACCAGAGGCTATGTTGCACCAGAATGGTTCAGGAACACAGCTGTGACTGCCAAAGTGGATGTTTATAGCTATGGCATCGTTTTGCTAGAAACCATTTGTTGCAGGAAGTGTATGGACATCGCTATGGAGAATGAAGAGGAAATACTACTGATCGAGTGGGTCTATGATTGTATCCACTCAAGAACGCTACATAAGCTAGTAAAAGACGATGAAGAGGCACTAAGCGACATGAAGCAGCTGGAGAAGCTTGTAAAAGTGGCGATTTGGTGCATTCAAGAGGATCCAAATGTCAGGCCCTCCATGAGAAGGGTAGTACATATGTTGGAAGGGGTTGTTGAAATCCCAATGCCTCCATTTCCTAATTGAACTTATGACTAATTAATATTGTGAGACACACTCCCTTATACTATTCTTGTAGCTTCAATGTGCCTCATGTTGTTTCATTAACTAAAATAGCCAATAAATTGTCATAGTTTGCTC


Protein sequences

Name Description Sequence
Nta.9987 translated coding region predicted by ESTScan from UniGene Nta.9987

XGAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVHMLEGVVEIPMPPFPN

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-276 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XGAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVHMLEGVVEIPMPPF

HMMSmart: SM00220
IPR002290
1-265 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

XGAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVHML

HMMSmart: SM00219
IPR020635
1-265 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

XGAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVHML

superfamily: SSF56112
IPR011009
2-265 Protein kinase-like (PK-like)
Protein kinase-like domain

GAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVHML

HMMPfam: PF00069
IPR017442
2-263 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

GAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVH

HMMPanther: PTHR24420:SF815
2-277 RLK1 (RECEPTOR-LIKE PROTEIN KINASE 1); CARBOHYDRATE BINDING / KINASE

GAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVHMLEGVVEIPMPPFP

HMMPanther: PTHR24420
2-277 FAMILY NOT NAMED,FAMILY NOT NAMED

GAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGFCDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVVHMLEGVVEIPMPPFP

Gene3D: G3DSA:3.30.200.20
2-58 no description

GAFGIVYKGELSSSNSRTVVAVKKLDKLANDGENEFKTEASVIARTHHKNLVRLVGF

Gene3D: G3DSA:1.10.510.10
59-262 no description

CDEGPEKKLLVYEFMSHGSLADFLFSQSRQQWNKRIRIAYGVARGISYLHEECSTQIIHCDIKPQNILLDDSFEARISDFGLAKLLMKGQTRTLTGIRGTRGYVAPEWFRNTAVTAKVDVYSYGIVLLETICCRKCMDIAMENEEEILLIEWVYDCIHSRTLHKLVKDDEEALSDMKQLEKLVKVAIWCIQEDPNVRPSMRRVV

PatternScan: PS00108
IPR008271
115-127 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IIHCDIKPQNILL

Seg: seg
147-160 seg

GQTRTLTGIRGTRG






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox