PRGDB00071627 (Nta.10641)

From PRG Wiki
Jump to: navigation, search
Nta.10641
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 190137808 (FG637747)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Nicotiana tabacum

Comment?

TT-34_F04 Samsun trichome library Nicotiana tabacum cDNA, mRNA sequence

DNA Sequence

TTCATACAGGGTCGGAGCGTGGAATCATCCATAGGGATGTCAAGACAACTAACATATTGTTAGATGAGAATCTTGTAGCGAAGATGGCAGATTTTGGACTGTCTAAAACTGGCCCGTCTTTGGAGCATACTCATGTCAGTACAGCAGTGAAAGGAAGTTTTGGTTATCTGGATCCTGAGTATTTCAGGCGGCAGCAGTTGACTGAGAAATCTGATGTTATTCCTTTGGTGTTGTGCTGTTTGAAGTCGTCTGTGCGCGCCCTGTTATAAATCCAAGCTTACCAAGAGATCAGATCAATCTTGCAGAATGGGCGATGCGGTTTCAACGACAAAGAGAGCTTGAAACCATCGTTGACCCACAACTCGCAGGAAATTATTCCCCAGAGTCATTGATGAAATTTGGAGAAATTGCTGAGAAATGTCTAGCGGACGAGGGGAAGAGCAGACCCACAATGGGAGAAGTCCTATGGCACCTGGAATATGTCTTACAACTTCATGAGGCTTGGCTGCGGACAAATGCAGGGGAAAACTCTGCTTCTGATATTCGTGCTCTGGAGACTGTTGAGGAGAGAGGAACTGAAAATTCNGAAGACGAGACTCATGTTGATTCAA


Protein sequences

Name Description Sequence
Nta.10641 translated coding region predicted by ESTScan from UniGene Nta.10641

XHTGSERGIIHRDVKTTNILLDENLVAKMADFGLSKTGPSLEHTHVSTAVKGSFGYLDPEYFRRQQLTEKSDVIPLVLCCLKSSVRRPVINPSLPRDQINLAEWAMRFQRQRELETIVDPQLAGNYSPESLMKFGEIAEKCLADEGKSRPTMGEVLWHLEYVLQLHEAWLRTNAGENSASDIRALETVEERGTENSEDETHVDSX

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-161 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XHTGSERGIIHRDVKTTNILLDENLVAKMADFGLSKTGPSLEHTHVSTAVKGSFGYLDPEYFRRQQLTEKSDVIPLVLCCLKSSVRRPVINPSLPRDQINLAEWAMRFQRQRELETIVDPQLAGNYSPESLMKFGEIAEKCLADEGKSRPTMGEVLWHLEY

superfamily: SSF56112
IPR011009
2-167 Protein kinase-like (PK-like)
Protein kinase-like domain

HTGSERGIIHRDVKTTNILLDENLVAKMADFGLSKTGPSLEHTHVSTAVKGSFGYLDPEYFRRQQLTEKSDVIPLVLCCLKSSVRRPVINPSLPRDQINLAEWAMRFQRQRELETIVDPQLAGNYSPESLMKFGEIAEKCLADEGKSRPTMGEVLWHLEYVLQLHE

HMMPanther: PTHR24420:SF743
2-203 SUBFAMILY NOT NAMED

HTGSERGIIHRDVKTTNILLDENLVAKMADFGLSKTGPSLEHTHVSTAVKGSFGYLDPEYFRRQQLTEKSDVIPLVLCCLKSSVRRPVINPSLPRDQINLAEWAMRFQRQRELETIVDPQLAGNYSPESLMKFGEIAEKCLADEGKSRPTMGEVLWHLEYVLQLHEAWLRTNAGENSASDIRALETVEERGTENSEDETHVD

HMMPanther: PTHR24420
2-203 FAMILY NOT NAMED,FAMILY NOT NAMED

HTGSERGIIHRDVKTTNILLDENLVAKMADFGLSKTGPSLEHTHVSTAVKGSFGYLDPEYFRRQQLTEKSDVIPLVLCCLKSSVRRPVINPSLPRDQINLAEWAMRFQRQRELETIVDPQLAGNYSPESLMKFGEIAEKCLADEGKSRPTMGEVLWHLEYVLQLHEAWLRTNAGENSASDIRALETVEERGTENSEDETHVD

Gene3D: G3DSA:1.10.510.10
6-159 no description

ERGIIHRDVKTTNILLDENLVAKMADFGLSKTGPSLEHTHVSTAVKGSFGYLDPEYFRRQQLTEKSDVIPLVLCCLKSSVRRPVINPSLPRDQINLAEWAMRFQRQRELETIVDPQLAGNYSPESLMKFGEIAEKCLADEGKSRPTMGEVLWHL

HMMPfam: PF00069
IPR017442
6-158 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

ERGIIHRDVKTTNILLDENLVAKMADFGLSKTGPSLEHTHVSTAVKGSFGYLDPEYFRRQQLTEKSDVIPLVLCCLKSSVRRPVINPSLPRDQINLAEWAMRFQRQRELETIVDPQLAGNYSPESLMKFGEIAEKCLADEGKSRPTMGEVLWH

PatternScan: PS00108
IPR008271
9-21 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IIHRDVKTTNILL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox