PRGDB00071649 (Nta.12080)

From PRG Wiki
Jump to: navigation, search
Nta.12080
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 156648566 (AM841986)
Gene Class Unknown
Domain Type
Gene Species Nicotiana tabacum

Comment?

AM841986 COL, cold overnight library Nicotiana tabacum cDNA clone nt006142024, mRNA sequence

DNA Sequence

TTTAGTCAAACGGGATAACAAGTTGCTTATACAATAGGAGTACTACTTAAGAAACACTAACAGTGATCTGCATTCTCTTACTTTTTGCACATATTGCAGAAATATACTAATACCACTATTTTCCAAAGCCACTAATGGCCTCTCTTGCTTCTTGATACTTTCTGGTTGCCATCTCATAGATTTTAGTGTCTTCTTCTGTGAAAGTTCCTACTTCTTTGACCTCTCCTCTTTGTTCTGTATGTCAGTTCATGAGTGATAGTTGCAAAAAAGTCTACGAACCATCTTGGCCTTTCAAAACAGTATATGAGATACAGGACGGTAAATCCAAATATCAAGCCACAACCATACCCAATTAAGACAGATTTCCAAGTCATTTCACTAAGAAAACTCGGCTCATCTTCTTCTTGTTCAACCAATAATCCTGGTACTGATGCACTCTTACGATGCCCACATTCAGTTGACAATGGAAACCCACACAAATCACTGTTTCCAAAATATGAATCATTTGGAAATGTATTGAACTGATTACTATGAGGAATAGGTCCAACAAGATG


Protein sequences

Name Description Sequence
Nta.12080 translated coding region predicted by ESTScan from UniGene Nta.12080

HLVGPIPHSNQFNTFPNDSYFGNSDLCGFPLSTECGHRKSASVPGLLVEQEEDEPSFLSEMTWKSVLIGYGCGLIFGFTVLYLIYCFERPRWFVDFFATITHELTYRTKRRGQRSRNFHRRRH







List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox