PRGDB00071665 (Nta.13083)

From PRG Wiki
Jump to: navigation, search
Nta.13083
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 156667194 (AM802734)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Nicotiana tabacum

Comment?

AM802734 COL, cold overnight library Nicotiana tabacum cDNA clone nt006161085, mRNA sequence

DNA Sequence

CTCATGCGGCCGCTAGGACTCGTGGAATTCAGGACAGAGATCGAGATGTTATCCAAGCTTCGCCATAGACATCTAGTTTCGCTAATTGGCTATTGTGAGGAGCTCAATGAGATGATCCTCGTATACGAATTCATGGCAGGTGGACCGCTTAGAAAACATTTGTATGGATCAGATATTCCTCATCTGTCATGGAAACAAAGACTAGAAGTATGCATTGGAGCTGCAAAAGGATTGCATTATCTTCACACGGGGGCAGCCGAGTGCATCATCCACCGCGATGTCAAGACTACCAACATCTTGTTAGACGAAAATCTCACCGCAAAAGTGGCTGATTTTGGTCTATCAAAATTTGGTCCTGCATTAGATCAAACTCATGTGAGTACTGCTGTGAAGGGAAGTTTTGGTTACCTTGATCCAGAGTATTATCGTCGACAGCAACTTACAGAGAAGTCTGATGTCTATTCTTTTGGAGTAGTACTTATGGAGGTTCTATGTGCTCGGTCAGCAATCAATCCGTCTCTTCCAAGAGAACAAGTAAATATAGCGGAATGGGCAATGCATTGGCAGAA


Protein sequences

Name Description Sequence
Nta.13083 translated coding region predicted by ESTScan from UniGene Nta.13083

LMRPLGLVEFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSLPREQVNIAEWAMHWQX

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-190 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

LMRPLGLVEFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSLPREQVNIAEWAMHWQX

HMMSmart: SM00219
IPR020635
1-185 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

LMRPLGLVEFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSLPREQVNIAEWA

HMMSmart: SM00220
IPR002290
2-185 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

MRPLGLVEFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSLPREQVNIAEWA

HMMPanther: PTHR24420:SF418
6-189 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

GLVEFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSLPREQVNIAEWAMHWQ

HMMPanther: PTHR24420
6-189 FAMILY NOT NAMED,FAMILY NOT NAMED

GLVEFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSLPREQVNIAEWAMHWQ

Gene3D: G3DSA:3.30.200.20
9-37 no description

EFRTEIEMLSKLRHRHLVSLIGYCEELNE

superfamily: SSF56112
IPR011009
9-186 Protein kinase-like (PK-like)
Protein kinase-like domain

EFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSLPREQVNIAEWAM

HMMPfam: PF07714
IPR001245
9-174 Pkinase_Tyr
Serine-threonine/tyrosine-protein kinase catalytic

EFRTEIEMLSKLRHRHLVSLIGYCEELNEMILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAINPSL

Gene3D: G3DSA:1.10.510.10
38-171 no description

MILVYEFMAGGPLRKHLYGSDIPHLSWKQRLEVCIGAAKGLHYLHTGAAECIIHRDVKTTNILLDENLTAKVADFGLSKFGPALDQTHVSTAVKGSFGYLDPEYYRRQQLTEKSDVYSFGVVLMEVLCARSAIN

PatternScan: PS00108
IPR008271
89-101 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IIHRDVKTTNILL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox