PRGDB00071750 (Nta.18217)

From PRG Wiki
Jump to: navigation, search
Nta.18217
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 156647813 (AM834680)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Nicotiana tabacum

Comment?

AM834680 DL, diurnal library Nicotiana tabacum cDNA clone nt005162041, mRNA sequence

DNA Sequence

CCCTCATGCGGCCGCTACTGACATGAATCCCAAGGTATCGGATTTTGGCATAGCTAGAACTGTGATAGGGAATGAGACTAGTGCTAATACACACCATGTAGTTGGGACACATGGCTACATGTCCCCAGAGTATGTGGTCGATGGTGTTTTCTCAATTAAATCAGATGTATTTAGCTTTGGCGTGTTAGTGCTAGAGATAATCAGTGGCAAGAGGAACAGAGGATTTTCCCATGGAAGTCGCAATATCAACCTTCTCGGACATGCGTGGAGACTTTATAAAGAAGGTAGAACATTGGAGCTAATTGATGTGCATCTAACGGATTCGTGTTATTTTTCTGAATTGCTACGGTTAATCCATGTCGCTCTGTTATGTGTACAACAACGTCCAGAAAACAGACCAGACATGTCTACAGTTGTTGTGATGTTGGCTAATGACGCTGTTTTGCCTCAAGCTAAGGAACCTGGTTTTTTTCACAGGAAGCAAATTTACTGATTCTGATTATTCTTCAACCAAATATACAACAAATGAAG


Protein sequences

Name Description Sequence
Nta.18217 translated coding region predicted by ESTScan from UniGene Nta.18217

XPHAAATDMNPKVSDFGIARTVIGNETSANTHHVVGTHGYMSPEYVVDGVFSIKSDVFSFGVLVLEIISGKRNRGFSHGSRNINLLGHAWRLYKEGRTLELIDVHLTDSCYFSELLRLIHVALLCVQQRPENRPDMSTVVVMLANDAVLPQAKEPGFFHRKQIY

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-149 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XPHAAATDMNPKVSDFGIARTVIGNETSANTHHVVGTHGYMSPEYVVDGVFSIKSDVFSFGVLVLEIISGKRNRGFSHGSRNINLLGHAWRLYKEGRTLELIDVHLTDSCYFSELLRLIHVALLCVQQRPENRPDMSTVVVMLANDAVL

superfamily: SSF56112
IPR011009
8-143 Protein kinase-like (PK-like)
Protein kinase-like domain

DMNPKVSDFGIARTVIGNETSANTHHVVGTHGYMSPEYVVDGVFSIKSDVFSFGVLVLEIISGKRNRGFSHGSRNINLLGHAWRLYKEGRTLELIDVHLTDSCYFSELLRLIHVALLCVQQRPENRPDMSTVVVML

Gene3D: G3DSA:1.10.510.10
8-143 no description

DMNPKVSDFGIARTVIGNETSANTHHVVGTHGYMSPEYVVDGVFSIKSDVFSFGVLVLEIISGKRNRGFSHGSRNINLLGHAWRLYKEGRTLELIDVHLTDSCYFSELLRLIHVALLCVQQRPENRPDMSTVVVML

HMMPanther: PTHR24420:SF430
8-162 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

DMNPKVSDFGIARTVIGNETSANTHHVVGTHGYMSPEYVVDGVFSIKSDVFSFGVLVLEIISGKRNRGFSHGSRNINLLGHAWRLYKEGRTLELIDVHLTDSCYFSELLRLIHVALLCVQQRPENRPDMSTVVVMLANDAVLPQAKEPGFFHRKQ

HMMPanther: PTHR24420
8-162 FAMILY NOT NAMED,FAMILY NOT NAMED

DMNPKVSDFGIARTVIGNETSANTHHVVGTHGYMSPEYVVDGVFSIKSDVFSFGVLVLEIISGKRNRGFSHGSRNINLLGHAWRLYKEGRTLELIDVHLTDSCYFSELLRLIHVALLCVQQRPENRPDMSTVVVMLANDAVLPQAKEPGFFHRKQ

HMMPfam: PF07714
IPR001245
11-142 Pkinase_Tyr
Serine-threonine/tyrosine-protein kinase

PKVSDFGIARTVIGNETSANTHHVVGTHGYMSPEYVVDGVFSIKSDVFSFGVLVLEIISGKRNRGFSHGSRNINLLGHAWRLYKEGRTLELIDVHLTDSCYFSELLRLIHVALLCVQQRPENRPDMSTVVVM






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox