PRGDB00071823 (Nta.23697)

From PRG Wiki
Jump to: navigation, search
Nta.23697
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 224698940 (FG624896)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Nicotiana tabacum

Comment?

TOBESTR042D12 TOBEST cDNA library 1 Nicotiana tabacum cDNA 5', mRNA sequence

DNA Sequence

CTTTTGCTGTTCAAAGGTAGGGGAGAGTGCTTTCTGATCTACGACTTTGTCCCCAATGGAAATTTGTTGCAGTACCTTGACGTGAAGGATGGAAAAGGAAAGGTCCTCGATTGGTCTACCAAACTTCACATAATCAAAGGCGTTGCTAGAGGTATCCAGTATTTGCATGGAAACAAGGGAAGCAAACCTGCTCTAGTCCATAGAAATATATCAGCTGAAAAAGTACTCATTGACCAGCGCTACAACCCATTGCTCTCAGATTCTGGTCTGCCCAAACTACTAGCAGATGACATTGTGTTCTCAACACTCAAGGAAAGTGCTGCAATGGGCTACCTAGCTCCCGAGTATACAACCACTGGCAGATTCACTGAAAAGAGTGATCTCTACGCATTTGGTGTGATTATTTTTCAGATTCTCTCTGGAAAGCGCAGAATCACTCACTCGAACCATCAAGGGGCAGAGTTGTGCAGATACGAAGACTTCATTGATCCGAAACTTGGGGGCAACTTTGAAGAAGCTGAGGCAGTCCAGATGGCAAAGGTTGCTTTACTTTGCACTCACGAGTCACCAAATCAGAGGCCAAACATTGAAGTCGTCATGCAAGAACTGAATGATCTAATCTCCCAGCAGTCGTGAATGCT


Protein sequences

Name Description Sequence
Nta.23697 translated coding region predicted by ESTScan from UniGene Nta.23697

LLLFKGRGECFLIYDFVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQELNDLISQQSXML

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-207 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

LLLFKGRGECFLIYDFVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQELNDLI

HMMSmart: SM00219
IPR020635
1-203 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

LLLFKGRGECFLIYDFVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQEL

HMMSmart: SM00220
IPR002290
3-207 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

LFKGRGECFLIYDFVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQELNDLI

HMMPanther: PTHR24420
7-207 FAMILY NOT NAMED,FAMILY NOT NAMED

RGECFLIYDFVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQELNDLI

superfamily: SSF56112
IPR011009
7-203 Protein kinase-like (PK-like)
Protein kinase-like domain

RGECFLIYDFVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQEL

HMMPfam: PF07714
IPR001245
8-203 Pkinase_Tyr
Serine-threonine/tyrosine-protein kinase

GECFLIYDFVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQEL

Gene3D: G3DSA:1.10.510.10
16-204 no description

FVPNGNLLQYLDVKDGKGKVLDWSTKLHIIKGVARGIQYLHGNKGSKPALVHRNISAEKVLIDQRYNPLLSDSGLPKLLADDIVFSTLKESAAMGYLAPEYTTTGRFTEKSDLYAFGVIIFQILSGKRRITHSNHQGAELCRYEDFIDPKLGGNFEEAEAVQMAKVALLCTHESPNQRPNIEVVMQELN






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox