PRGDB00073515 (Pgl.30)

From PRG Wiki
Jump to: navigation, search
Pgl.30
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 157543047 (EX344278)
Gene Class Unknown
Domain Type
Gene Species Picea glauca

Comment?

GQ03102.B7_F06 GQ031 - Xylem Scrapings (Normalized library) Picea glauca cDNA clone GQ03102_F06 5', mRNA sequence

DNA Sequence

TGATATTTACAGTTTTGGAATCCTTCTCCTGGAAACTATCACAGGTAGAGAACCAGTTGACTACGGTCGGCCTGCAGGCGAGGTGAACCTTGTAGAATGGTTAAAGATGATGATAGGAAGTAAACGCTCAGAAGAGGTTGTAGACCCAAATATTGAAACGAAACCATCTACACGAGATTTGAAGAGGGCACTTTTGGTTGCCCTAAGATGTGTCGATCCAGATTCTGAGAAAAGACCTAGGATGGGACGTGTGGTGCGCATGCTTGAAGCAGATGAGTTTCCTTTCCGTGAGGATCGAAGAAGCAGACCCAACCATGCCAGAAACAAAACAGTTGACAGTCAAGGGGGGGCAACCCAGAAAATTATAGCAGAAGGTTCAGCTTCTCGAGTTGTGGACTCACAAAGCAGACATATAGTGGAGCAGGCAAATACTAGGGAGAATAGCAAAAGGGGCAGGGGATTTGAACGCTGATCTCATCCATGATTCTGTTATTGGTTTCCAGGATTTTGTTCTTTTTATTGGGTTTTCAGAAAAGAAGTCTGATTGCATACTTTACTGCTCCCACTTATACGTTACATGGAAGCTAGTCAAAATACTGTTGCACTATATGGATTCTGTATAAGGGAAGCAGGTATTGTTTTCTCAGATTTCCGAATGCATTGTTGGGTGTTTTGCACCATGGAATACAACACGATTTCTGTAGTCAGTTTATTCACTTTCCCAAGTAAAGAATTTATACCTTTCTGCAGCAAGCTGAAAAGACAGCATAATTCGACCTGAAAGCTTATAACCTGGTAGAAAGATGTGTAAGGTGACAATCATGTACCAACCACTGCAGCAAGGTAGTTCGGGATTACAGCAAAATTATGCTGACTAGCTCAGCATATCATATGCCCTTTAGTATGCACATTATGCGTTCTGGGAAGGATTTGTC


Protein sequences

Name Description Sequence
Pgl.30 translated coding region predicted by ESTScan from UniGene Pgl.30

XDIYSFGILLLETITGREPVDYGRPAGEVNLVEWLKMMIGSKRSEEVVDPNIETKPSTRDLKRALLVALRCVDPDSEKRPRMGRVVRMLEADEFPFREDRRSRPNHARNKTVDSQGGATQKIIAEGSASRVVDSQSRHIVEQANTRENSKRGRGFER


Domains

Domain Start-End Description Sequence

superfamily: SSF56112
IPR011009
2-97 Protein kinase-like (PK-like)
Protein kinase-like domain

DIYSFGILLLETITGREPVDYGRPAGEVNLVEWLKMMIGSKRSEEVVDPNIETKPSTRDLKRALLVALRCVDPDSEKRPRMGRVVRMLEADEFPFR

HMMPanther: PTHR24420:SF937
2-155 SUBFAMILY NOT NAMED

DIYSFGILLLETITGREPVDYGRPAGEVNLVEWLKMMIGSKRSEEVVDPNIETKPSTRDLKRALLVALRCVDPDSEKRPRMGRVVRMLEADEFPFREDRRSRPNHARNKTVDSQGGATQKIIAEGSASRVVDSQSRHIVEQANTRENSKRGRGF

HMMPanther: PTHR24420
2-155 FAMILY NOT NAMED,FAMILY NOT NAMED

DIYSFGILLLETITGREPVDYGRPAGEVNLVEWLKMMIGSKRSEEVVDPNIETKPSTRDLKRALLVALRCVDPDSEKRPRMGRVVRMLEADEFPFREDRRSRPNHARNKTVDSQGGATQKIIAEGSASRVVDSQSRHIVEQANTRENSKRGRGF

Gene3D: G3DSA:1.10.510.10
2-89 no description

DIYSFGILLLETITGREPVDYGRPAGEVNLVEWLKMMIGSKRSEEVVDPNIETKPSTRDLKRALLVALRCVDPDSEKRPRMGRVVRML






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox