PRGDB00073520 (Pgl.394)

From PRG Wiki
Jump to: navigation, search
Pgl.394
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 211604867 (GE480004)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Picea glauca

Comment?

GQ02010.B3.r_N17 GQ020: Clean ROOTS systems -Diurnal cycle Picea glauca cDNA clone GQ02010_N17 5', mRNA sequence

DNA Sequence

TTTTAATATCAATAAAAGATGGTTTGCAAAGAGGCCTAACAAACTACAAAGTTGTCATTACATTAAGCCTCATCTGAATTGCAGCTTACTTGCTTCTGCAACAATGGTATAACTGTAGATTCTTGCTGTCAGTCAATACCAGCAAAGGCTTTCTCAAGAAATATTCATGGTTATATCCAAGTTTGAACTTCATGGTTCGCTTGACACTACGCTTGACACTATGAGCTCATTTGAATAATCAGCATCAGCCATGTCTGGTACCAGAAGGATGTCATCATTCTGATCAGAAAAGTTGTACCTTTCACCAATTGCTCTTAGCAGATGGTAAACCTCATACATGGAAGGTCTCTCCTTATGAGGGGAAAGAACACAAGCACAAGCCACCTTCAAAACCTGCAGGAGCTCATCATCTTGTCCCCTACCAATTAAAGATTTGTCAATGGCTTCAAGTACAAGACCATTTTTTGAAAGATGGCTGATCCACTCAACTAAATTACCCTTAAAGCTTTCCTGTACATTTGTAACTTCAATAGGTTTCTGTCTGGTAACCAACTCTAGAAGAACTACTCCAAAACTATAGACATCCCCTTTCAAAGTAGCAACCAAGGTGCTCATGTATTCGGGTGCCACATAACCCAAGTCGCCAAAATCACCATTGATAAAAGTACTAAGATGAGTATCGACAGGATTCATCAGCCGAGCCAGCCCAAAATCTGTTATCTTTGCCTCATGATTTTCATCCAATAAAATACAGTTTGAACTTACATTGCGGTGAATAATTCGGGGATTACAGCTGTGGTGAAGCCAGGCCAATCCTCTAGCTGCACCAATCCCTATCTTAAGCCTTCTAGTCCAATCAAGATAATTACCATCCTCTATTTCATGATCATGTAATCGCTCATACAAGGATCCATTAGCCATGTGTCTGTAAACTAA


Protein sequences

Name Description Sequence
Pgl.394 translated coding region predicted by ESTScan from UniGene Pgl.394

LVYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLLRAIGERYNFSDQNDDILLVPDMADADYSNELIVSSVVSSEP

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR24420:SF477
1-247 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

LVYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLLRAIGERYNFSDQNDDILLVPDMADADYSNELIVSSVVSSE

HMMPanther: PTHR24420
1-247 FAMILY NOT NAMED,FAMILY NOT NAMED

LVYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLLRAIGERYNFSDQNDDILLVPDMADADYSNELIVSSVVSSE

superfamily: SSF56112
IPR011009
1-215 Protein kinase-like (PK-like)
Protein kinase-like domain

LVYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLLRAIGERYN

HMMPfam: PF07714
IPR001245
1-205 Pkinase_Tyr
Serine-threonine/tyrosine-protein kinase

LVYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYH

ProfileScan: PS50011
IPR000719
1-207 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

LVYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLL

HMMSmart: SM00219
IPR020635
1-207 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

LVYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLL

HMMSmart: SM00220
IPR002290
2-210 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

VYRHMANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLLRAI

Gene3D: G3DSA:1.10.510.10
6-216 no description

MANGSLYERLHDHEIEDGNYLDWTRRLKIGIGAARGLAWLHHSCNPRIIHRNVSSNCILLDENHEAKITDFGLARLMNPVDTHLSTFINGDFGDLGYVAPEYMSTLVATLKGDVYSFGVVLLELVTRQKPIEVTNVQESFKGNLVEWISHLSKNGLVLEAIDKSLIGRGQDDELLQVLKVACACVLSPHKERPSMYEVYHLLRAIGERYNF






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox