PRGDB00073844 (Pgl.22658)

From PRG Wiki
Jump to: navigation, search
Pgl.22658
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 211868810 (DV988729)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Picea glauca

Comment?

GQ02012.TB_D01 GQ020: Clean ROOTS systems -Diurnal cycle Picea glauca cDNA clone GQ02012_D01 3', mRNA sequence

DNA Sequence

ATTTGCTTCATTATACATCATTTTACATGGAAGATATATGTATCATATTTGGTACCAAAGCAATCATGGGAAGGCGGAACGTAGGGTACCAAGTTAGAAATGGAAGCAATCTCCAGATGGAGGACCAAACCAATCATGGGAACGCCGAATTAGCCTAGGGTACCGAGTTAGTAATGAAAGCCTTAGCCTTAGCCTTAGATAGAGGAGCTACCAGAGGAGCCTGAGATGAAGCGGATAACACAGAAGAAGATGTGCTCGTGCCAGAAGAGTGTGAGAATCCGGAGCCAGAACTGGTGGACTTGGTGTTTTGGGAAACACTAGAACTCACAAAAGCAGGTTTTTTGGGAGCAGATAACGTCACAGAATGACTTGAAAGCATCAAAATGACCGAAGACATTGTTGGACGAAGTGATGAATCGGCTTGTGTACACAAAAGACCAACATGAATCCATCTCAATGCTTGCGCCTGATCGCACGTTTCAATTATTGTTGGATCAATCATCCGCAGAATATTTCCTCGTTTGTATAATCTCCATGCCCATCCTAAAAGCACCTGCATTTCAGGTGACAAATTGTGATCAGTGTTCTTTCTTCCTGTGATAAGTTCTAGGAGAACAACACCAAAGCTATAAACATCAGCTTTTACAGATAATTGCCCCTGCATAGCATACTCTGGTGCAATATACCCGAAAGTTCCAGCGACTCTTGTGCTGATGTGAGTCTGGTCTTCAGGAAAAAGTCTTGCTAAGCCGAAATCTGCAATCTTAGGATTCAGTTTTTCGTCCAACAAAATATTGCTTGCTTTAATATCCCGATGAATAATCCGCAATTGAGAATCCTCGTGCAAATAGAGAAGCCCCCGAGCCACTCCCACTATGATGCTGCAACGCTTCTGCCAATCAAGCTGGTAGCGTTTGTTT


Protein sequences

Name Description Sequence
Pgl.22658 translated coding region predicted by ESTScan from UniGene Pgl.22658

XNKRYQLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWIHVGLLCTQADSSLRPTMSSVILMLSSHSVTLSAPKKPAFVSSSVSQNTKSTSSGSGFSHSSGTSTSSSVLSASSQAPLVAPLSKAKAKAFITNSVP

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-189 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XNKRYQLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWIHVGLLCTQADSSLRPTMSSVILMLSSHSVT

HMMSmart: SM00220
IPR002290
1-159 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

XNKRYQLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWI

HMMPanther: PTHR24420:SF430
3-249 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

KRYQLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWIHVGLLCTQADSSLRPTMSSVILMLSSHSVTLSAPKKPAFVSSSVSQNTKSTSSGSGFSHSSGTSTSSSVLSASSQAPLVAPLSKAKAKAF

HMMPanther: PTHR24420
3-249 FAMILY NOT NAMED,FAMILY NOT NAMED

KRYQLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWIHVGLLCTQADSSLRPTMSSVILMLSSHSVTLSAPKKPAFVSSSVSQNTKSTSSGSGFSHSSGTSTSSSVLSASSQAPLVAPLSKAKAKAF

HMMSmart: SM00219
IPR020635
3-183 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

KRYQLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWIHVGLLCTQADSSLRPTMSSVILML

Gene3D: G3DSA:1.10.510.10
4-212 no description

RYQLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWIHVGLLCTQADSSLRPTMSSVILMLSSHSVTLSAPKKPAFVSSSVSQNTKSTSS

HMMPfam: PF00069
IPR017442
6-117 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

QLDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHN

superfamily: SSF56112
IPR011009
7-183 Protein kinase-like (PK-like)
Protein kinase-like domain

LDWQKRCSIIVGVARGLLYLHEDSQLRIIHRDIKASNILLDEKLNPKIADFGLARLFPEDQTHISTRVAGTFGYIAPEYAMQGQLSVKADVYSFGVVLLELITGRKNTDHNLSPEMQVLLGWAWRLYKRGNILRMIDPTIIETCDQAQALRWIHVGLLCTQADSSLRPTMSSVILML

PatternScan: PS00108
IPR008271
34-46 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IIHRDIKASNILL

Seg: seg
199-233 seg

VSSSVSQNTKSTSSGSGFSHSSGTSTSSSVLSASS






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox