PRGDB00073954 (Pin.5291)

From PRG Wiki
Jump to: navigation, search
Pin.5291
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 58148297 (CV958506)
Gene Class Unknown
Domain Type
Gene Species Phytophthora infestans

Comment?

PXrpxc_6162 mycelium, starved in water Phytophthora infestans cDNA, mRNA sequence

DNA Sequence

CCGGGTCGACCCACGCGTCCGCGCAAATGACGGCGCTGGTTGAGCGATTCATGAACTTGTACTGGCGTACTCCATCGTACAACTTGACTCGATTTGCCATTGCGCCACTTCTTGGCTTGCTCTTCGGCTTGATCTACGTCAGCGTGTCGTACACCTCGTACCAAGGCGTCAACGCCGGTGTTGGAATGGTCTTCATGACGACGTTATTCAATGGTGTAGTTGCCTTCAACAGCGTTCTACCGATCTCGTCGCAAGACCGCGAGGCGTTCTACCGTGAAAGAGCAGCACAAACGTACAACTCGCTCTGGTACTTCGTTGGTTCTACCGTCGCTGAGGTCCCCTACGTCTTCGGCTCCATGCTGCTGTACACGGTCATCTTTTACTGGTTCGTTGGCTTTACTGGGTTCGGGACTGCAGTTCTCTACTGGATCAACACGTCGTTGTTGGTTCTACTGCAGACTTATCTCGGTCAACTGCTGGTGTACGCGCTGCCGAGTGTGGAGGTTGCAGCTCTGTTGGGAGTCATGCTCAACTCGATTCTCTTCCTCTTCATGGGCTTCAACCCGCCGGCCAACGCCATTCCGTCCGGCTACAAGTGGCTGTACACGATTACTCCTC


Protein sequences

Name Description Sequence
Pin.5291 translated coding region predicted by ESTScan from UniGene Pin.5291

MTALVERFMNLYWRTPSYNLTRFAIAPLLGLLFGLIYVSVSYTSYQGVNAGVGMVFMTTLFNGVVAFNSVLPISSQDREAFYRERAAQTYNSLWYFVGSTVAEVPYVFGSMLLYTVIFYWFVGFTGFGTAVLYWINTSLLVLLQTYLGQLLVYALPSVEVAALLGVMLNSILFLFMGFNPPANAIPSGYKWLYTITPX


Domains

Domain Start-End Description Sequence

HMMPanther: PTHR19241:SF10
1-197 ATP-BINDING CASSETTE TRANSPORTER (PDR),ATP-BINDING CASSETTE TRANSPORTER (PDR)

MTALVERFMNLYWRTPSYNLTRFAIAPLLGLLFGLIYVSVSYTSYQGVNAGVGMVFMTTLFNGVVAFNSVLPISSQDREAFYRERAAQTYNSLWYFVGSTVAEVPYVFGSMLLYTVIFYWFVGFTGFGTAVLYWINTSLLVLLQTYLGQLLVYALPSVEVAALLGVMLNSILFLFMGFNPPANAIPSGYKWLYTITP

HMMPanther: PTHR19241
1-197 FAMILY NOT NAMED,ATP-BINDING CASSETTE TRANSPORTER

MTALVERFMNLYWRTPSYNLTRFAIAPLLGLLFGLIYVSVSYTSYQGVNAGVGMVFMTTLFNGVVAFNSVLPISSQDREAFYRERAAQTYNSLWYFVGSTVAEVPYVFGSMLLYTVIFYWFVGFTGFGTAVLYWINTSLLVLLQTYLGQLLVYALPSVEVAALLGVMLNSILFLFMGFNPPANAIPSGYKWLYTITP

HMMPfam: PF01061
IPR013525
3-197 ABC2_membrane
ABC-2 type transporter

ALVERFMNLYWRTPSYNLTRFAIAPLLGLLFGLIYVSVSYTSYQGVNAGVGMVFMTTLFNGVVAFNSVLPISSQDREAFYRERAAQTYNSLWYFVGSTVAEVPYVFGSMLLYTVIFYWFVGFTGFGTAVLYWINTSLLVLLQTYLGQLLVYALPSVEVAALLGVMLNSILFLFMGFNPPANAIPSGYKWLYTITP

Seg: seg
139-153 seg

LLVLLQTYLGQLLVY






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox