PRGDB00074282 (Ppe.1215)

From PRG Wiki
Jump to: navigation, search
Ppe.1215
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 209176488 (FC864015)
Gene Class Unknown
Domain Type
Gene Species Prunus persica

Comment?

PPN079H09-T7 PPN Prunus persica cDNA clone PPN079H09, mRNA sequence

DNA Sequence

GTCGGAAGAGGTACTAACTAGGAACGATAATATGTCGAAGACAGGTGAGGTCGTATGCGTTACCGGTGGAAGTGGGTGCATTGGATCATGGCTCGTCCGTCTCCTCCTCGACCGTAATTACACCGTCCATGCCACTGTCAAAGATCTCAAGGACGAGGGTGAGACGAAGCATCTAGAAGCCCTAGAAGGAGCAGCGACGCGTCTCCGTCTCTTCCAGATCGACCTCCTCGACTACAACTCCATCTTCGCCGCCATCAATGGCTGCTCCGGCGTCTTCCACCTCGCCTCTCCTTGCATCGTCGATCAAGTCCAAGACCCCGAGAAGGAGCTTCTGGACCCGGCGATCAAAGGAACGCTTAATGTTCTGACGGCAGCGAAGCAGGCTGGGGTCAGGCGAGTGGTGCTGACATCCTCCAACGCCGCCATCATTCCCAGCCCTTGCTGGCCGTCCGATAAGATCAAGGGTGAGGATTGCCGGACCGATATTGACTACTGCAAGCAGAAGGGATTGTGGTATTCATTGTCGAAAACTTTGGCGGAGAAAGCTGCGTGGGAATTTGCCAAGGAGAAGGGATTGGATGTGGTTGTGGTGAATCCTGGCACCGTGTTGGGCGATGTCATTTCGCCCAGGCTCAATTCTAGCATGGTGACGCTAGTGCGCCTTCTTGAGGGCTGCACTGAAACATACGAGAACATCTTTATGGGATCTGTGCATTTAAAGATGTAGCTCT


Protein sequences

Name Description Sequence
Ppe.1215 translated coding region predicted by ESTScan from UniGene Ppe.1215

XSEEVLTRNDNMSKTGEVVCVTGGSGCIGSWLVRLLLDRNYTVHATVKDLKDEGETKHLEALEGAATRLRLFQIDLLDYNSIFAAINGCSGVFHLASPCIVDQVQDPEKELLDPAIKGTLNVLTAAKQAGVRRVVLTSSNAAIIPSPCWPSDKIKGEDCRTDIDYCKQKGLWYSLSKTLAEKAAWEFAKEKGLDVVVVNPGTVLGDVISPRLNSSMVTLVRLLEGCTETYENIFMGSVHLKMXLX

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR10366:SF9
1-241 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

XSEEVLTRNDNMSKTGEVVCVTGGSGCIGSWLVRLLLDRNYTVHATVKDLKDEGETKHLEALEGAATRLRLFQIDLLDYNSIFAAINGCSGVFHLASPCIVDQVQDPEKELLDPAIKGTLNVLTAAKQAGVRRVVLTSSNAAIIPSPCWPSDKIKGEDCRTDIDYCKQKGLWYSLSKTLAEKAAWEFAKEKGLDVVVVNPGTVLGDVISPRLNSSMVTLVRLLEGCTETYENIFMGSVHLK

HMMPanther: PTHR10366
1-241 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

XSEEVLTRNDNMSKTGEVVCVTGGSGCIGSWLVRLLLDRNYTVHATVKDLKDEGETKHLEALEGAATRLRLFQIDLLDYNSIFAAINGCSGVFHLASPCIVDQVQDPEKELLDPAIKGTLNVLTAAKQAGVRRVVLTSSNAAIIPSPCWPSDKIKGEDCRTDIDYCKQKGLWYSLSKTLAEKAAWEFAKEKGLDVVVVNPGTVLGDVISPRLNSSMVTLVRLLEGCTETYENIFMGSVHLK

superfamily: SSF51735
6-225 NAD(P)-binding Rossmann-fold domains

LTRNDNMSKTGEVVCVTGGSGCIGSWLVRLLLDRNYTVHATVKDLKDEGETKHLEALEGAATRLRLFQIDLLDYNSIFAAINGCSGVFHLASPCIVDQVQDPEKELLDPAIKGTLNVLTAAKQAGVRRVVLTSSNAAIIPSPCWPSDKIKGEDCRTDIDYCKQKGLWYSLSKTLAEKAAWEFAKEKGLDVVVVNPGTVLGDVISPRLNSSMVTLVRLLEG

Gene3D: G3DSA:3.40.50.720
IPR016040
18-224 no description
NAD(P)-binding domain

VVCVTGGSGCIGSWLVRLLLDRNYTVHATVKDLKDEGETKHLEALEGAATRLRLFQIDLLDYNSIFAAINGCSGVFHLASPCIVDQVQDPEKELLDPAIKGTLNVLTAAKQAGVRRVVLTSSNAAIIPSPCWPSDKIKGEDCRTDIDYCKQKGLWYSLSKTLAEKAAWEFAKEKGLDVVVVNPGTVLGDVISPRLNSSMVTLVRLLE

HMMPfam: PF01370
IPR001509
19-207 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGGSGCIGSWLVRLLLDRNYTVHATVKDLKDEGETKHLEALEGAATRLRLFQIDLLDYNSIFAAINGCSGVFHLASPCIVDQVQDPEKELLDPAIKGTLNVLTAAKQAGVRRVVLTSSNAAIIPSPCWPSDKIKGEDCRTDIDYCKQKGLWYSLSKTLAEKAAWEFAKEKGLDVVVVNPGTVLGDV

Seg: seg
180-191 seg

AEKAAWEFAKEK






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox