PRGDB00074313 (Ppe.14746)

From PRG Wiki
Jump to: navigation, search
Ppe.14746
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 209174307 (FC861673)
Gene Class Unknown
Domain Type
Gene Species Prunus persica

Comment?

PPN077F05-T7 PPN Prunus persica cDNA clone PPN077F05, mRNA sequence

DNA Sequence

GGAAACGAAACAAAAACCGAAAGAGCGCGAATGGACAACAAAAAGCCCATCGTTTGTGTTCTTGATGCTTCAACCTACGTGGGCTTCTGGATTCTGAAAGGATTGCTTGGTAGAGGTTTCACAGTCCACGCAGCCATCCAGAATAATGGGGAAACAGAAATTCAGAAGAGAATTAGGGAGATGGAGAAAGTAGAAGAGAGATTGGAAGTGTTTGTTGTGGATGTTTTGGACTACCATAGCATTCTTTTGGCTTTGAAGGGTTGCTCTGCTATGTTCTGCTGTTTAGATAGTTCAGATGGATATGATGAAAAAATGGTGGATTTGGAGGTGAGAGGAGCAATTAATGTTGTGGAAGCATGTGCTCAGACAGAGACTCTGGAGAAGATTGTGTTCACTTCTTCTTTGACTGCAGCAATTTGGAGAGAGGACATTTGTTCTGAGAAGGATGTGGATGAGAAATCATGGAGTGATCAGGATTTTTGCAGGAAATTGAAGTTGTGGTACGCCCTGGCAAAGACACTCTCAGAACAGGCTGCTTGGGCTTTATCCATGGACCGGATGCTCAAGATGGTTTCCATAAACTCTGGACTTGTCCTTGGGCCCAGTGTCGCCCAACAGAACCCTCGGACAACTATGTCTTATCTTAACGGAGCGGCTCAAATGTACGAAAACGGGGTGCTTGCATTCGTCGACGTGAACTTTCTAGCCG


Protein sequences

Name Description Sequence
Ppe.14746 translated coding region predicted by ESTScan from UniGene Ppe.14746

GNETKTERARMDNKKPIVCVLDASTYVGFWILKGLLGRGFTVHAAIQNNGETEIQKRIREMEKVEERLEVFVVDVLDYHSILLALKGCSAMFCCLDSSDGYDEKMVDLEVRGAINVVEACAQTETLEKIVFTSSLTAAIWREDICSEKDVDEKSWSDQDFCRKLKLWYALAKTLSEQAAWALSMDRMLKMVSINSGLVLGPSVAQQNPRTTMSYLNGAAQMYENGVLAFVDVNFLAX

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR10366:SF9
2-236 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

NETKTERARMDNKKPIVCVLDASTYVGFWILKGLLGRGFTVHAAIQNNGETEIQKRIREMEKVEERLEVFVVDVLDYHSILLALKGCSAMFCCLDSSDGYDEKMVDLEVRGAINVVEACAQTETLEKIVFTSSLTAAIWREDICSEKDVDEKSWSDQDFCRKLKLWYALAKTLSEQAAWALSMDRMLKMVSINSGLVLGPSVAQQNPRTTMSYLNGAAQMYENGVLAFVDVNFLA

HMMPanther: PTHR10366
2-236 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

NETKTERARMDNKKPIVCVLDASTYVGFWILKGLLGRGFTVHAAIQNNGETEIQKRIREMEKVEERLEVFVVDVLDYHSILLALKGCSAMFCCLDSSDGYDEKMVDLEVRGAINVVEACAQTETLEKIVFTSSLTAAIWREDICSEKDVDEKSWSDQDFCRKLKLWYALAKTLSEQAAWALSMDRMLKMVSINSGLVLGPSVAQQNPRTTMSYLNGAAQMYENGVLAFVDVNFLA

superfamily: SSF51735
11-236 NAD(P)-binding Rossmann-fold domains

MDNKKPIVCVLDASTYVGFWILKGLLGRGFTVHAAIQNNGETEIQKRIREMEKVEERLEVFVVDVLDYHSILLALKGCSAMFCCLDSSDGYDEKMVDLEVRGAINVVEACAQTETLEKIVFTSSLTAAIWREDICSEKDVDEKSWSDQDFCRKLKLWYALAKTLSEQAAWALSMDRMLKMVSINSGLVLGPSVAQQNPRTTMSYLNGAAQMYENGVLAFVDVNFLA

Gene3D: G3DSA:3.40.50.720
IPR016040
15-217 no description
NAD(P)-binding domain

KPIVCVLDASTYVGFWILKGLLGRGFTVHAAIQNNGETEIQKRIREMEKVEERLEVFVVDVLDYHSILLALKGCSAMFCCLDSSDGYDEKMVDLEVRGAINVVEACAQTETLEKIVFTSSLTAAIWREDICSEKDVDEKSWSDQDFCRKLKLWYALAKTLSEQAAWALSMDRMLKMVSINSGLVLGPSVAQQNPRTTMSYLNG

HMMPfam: PF01370
IPR001509
23-219 Epimerase
NAD-dependent epimerase/dehydratase

ASTYVGFWILKGLLGRGFTVHAAIQNNGETEIQKRIREMEKVEERLEVFVVDVLDYHSILLALKGCSAMFCCLDSSDGYDEKMVDLEVRGAINVVEACAQTETLEKIVFTSSLTAAIWREDICSEKDVDEKSWSDQDFCRKLKLWYALAKTLSEQAAWALSMDRMLKMVSINSGLVLGPSVAQQNPRTTMSYLNGAA






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox