PRGDB00075175 (Pth.5040)

From PRG Wiki
Jump to: navigation, search
Pth.5040
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 224092805 (XM_002309672)
Gene Class Mlo-like
Domain Type MLO
Gene Species Populus trichocarpa

Comment?

Populus trichocarpa predicted protein, mRNA

DNA Sequence

ATGGCAGAAGGAGGGACAACCTTAGAGTACACTCCCACATGGGTTGTGGCAGCGGTTTGCTCTGTTATTGTTCTCATTTCTCTTATTGTTGAAAGATTCCTTCACCTCCTTGGCAAGTTATTGAAGAGAAAACACCAGAAACCGCTCTTTGAAGCCTTACAGAAAATCAAAGAAGAGTTGATGCTTTTGGGGTTTATATCACTGCTACTGACAGTGTTCCAAGGCAGAATTAACACTATCTGCATTTCTGAGGATTTGTCTAAGAAAATGCTGCCCTGCAAGAAAGAAACTAAAGGAACTACTGCCCACTTCCAGGCTTTCTTTTCCTTCTTTCCTGGTGGGACTTCCCGACGCCTATTAGCCGAGGACTCCCCCGCTAATTCTTGTCCCGAGGGAAAGGTTCCTATGTTATCTACAACAGCACTGCATCATCTTCATATATTTATCTTCGTGCTTGCTTGTGTGCATGTGGTTTTCTGTGCTCTAACCATTCTTTTCGGAAGTGCTAAGATAAGGCAGTGGAAACGTTGGGAGGATTCTATCTCGAACAAGGAACAAGATCCAGAACAAGGTATTGCTTATCCAAAGCTTACGAATGTTCAAGACCATGATTTTATCAAGACACGCTATCTGGGTTTTGGAAAGAATTCTTACTTTCTGGGTTGGGTGCAATCATTTTTCAAGCAGTTCTATGGATCGGTAACAAGATCTGATTATATCACATTGCGACTTGGCTTCATTATGACTCATTGCAGGGGAAACCTAAAGTTTAATTTTCACAAATACATGATGCGAGCCCTTGAAGCTGACTTTAAGAAAGTTGTTGGAATAAGTTGGTATCTTTGGTTATTTGTGGTTCTTTTCTTGTTGCTGAATGTTGCTGGCTGGCATGCATATTTCTGGATTGCATTCATACCCTTCATTCTTCTACTAGCCGTGGGAACTAAGTTGGAGCATGTAATCTCTCAGTTGGCCCATGAGGTCGCCGAGAAACATGTAGCAGTCCAAGGGGATTTGGTTGTTCATCCTTCAGATGATCACTTCTGGTTCAACAAGCCTAAAATCGTTCTTATTTTGATCCACATCATTTTATTCCAAAACTCTTTCGAAATGGCATTTTTCTTCTGGATATGGCTACAATATGGTTTCGACTCCTGCATAATGGGACAAGTTAGTTATATTATTCCAAGACTCGTTATAGGGGCATTCATTCAGTTGCTCTGCAGTTACAGTACCCTACCACTCTATGCAATTGTGACACAGATGGGAAGTTCATTTAAGAAAGCAATATTTGATGAACATGTTCAAGAAGGGCTTGTGGGTTGGGCTAAGCAAGCAAAAAAGAAGACAGTGTTGAGAAAGGCTGCAAATGAATCTACCCATAACCAAGTCGTTCACAGAGAGGAGTCTCCTCTGATTCAGATGGCAAAGGCTGGATCAAAGTAGACTGCAATGGAAGAGAACAAACCAGGAGAGATTGTACATGGAACTGCATACTATGGAACTAAATGAACTACCTTGGAGGCACTCAGAAACCGATTTACCTGCCAACTCTGTAATATATAGTAGTATATAAGCTGAGAGAGTCGATGTTTTTGACATTAGACAGCTAGAAAAGAAGGGTTGCAATAGATATCTCACCTGGAACTTGGTTTTACCAACTAAATCTATATTCCAAGTTCCAGATTCACAAACAATTTTGTAAGATTTTGCTTGTGTTGGTATATTCAAGAATTCCATTTTCAAAAAA


Protein sequences

Name Description Sequence
Pth.5040 translated coding region predicted by ESTScan from UniGene Pth.5040

MAEGGTTLEYTPTWVVAAVCSVIVLISLIVERFLHLLGKLLKRKHQKPLFEALQKIKEELMLLGFISLLLTVFQGRINTICISEDLSKKMLPCKKETKGTTAHFQAFFSFFPGGTSRRLLAEDSPANSCPEGKVPMLSTTALHHLHIFIFVLACVHVVFCALTILFGSAKIRQWKRWEDSISNKEQDPEQGIAYPKLTNVQDHDFIKTRYLGFGKNSYFLGWVQSFFKQFYGSVTRSDYITLRLGFIMTHCRGNLKFNFHKYMMRALEADFKKVVGISWYLWLFVVLFLLLNVAGWHAYFWIAFIPFILLLAVGTKLEHVISQLAHEVAEKHVAVQGDLVVHPSDDHFWFNKPKIVLILIHIILFQNSFEMAFFFWIWLQYGFDSCIMGQVSYIIPRLVIGAFIQLLCSYSTLPLYAIVTQMGSSFKKAIFDEHVQEGLVGWAKQAKKKTVLRKAANESTHNQVVHREESPLIQMAKAGSKXTAMEENKPGEIVHGTAYYGTK

Domains

Domain Start-End Description Sequence

HMMPfam: PF03094
IPR004326
5-478 Mlo
Mlo-related protein

GTTLEYTPTWVVAAVCSVIVLISLIVERFLHLLGKLLKRKHQKPLFEALQKIKEELMLLGFISLLLTVFQGRINTICISEDLSKKMLPCKKETKGTTAHFQAFFSFFPGGTSRRLLAEDSPANSCPEGKVPMLSTTALHHLHIFIFVLACVHVVFCALTILFGSAKIRQWKRWEDSISNKEQDPEQGIAYPKLTNVQDHDFIKTRYLGFGKNSYFLGWVQSFFKQFYGSVTRSDYITLRLGFIMTHCRGNLKFNFHKYMMRALEADFKKVVGISWYLWLFVVLFLLLNVAGWHAYFWIAFIPFILLLAVGTKLEHVISQLAHEVAEKHVAVQGDLVVHPSDDHFWFNKPKIVLILIHIILFQNSFEMAFFFWIWLQYGFDSCIMGQVSYIIPRLVIGAFIQLLCSYSTLPLYAIVTQMGSSFKKAIFDEHVQEGLVGWAKQAKKKTVLRKAANESTHNQVVHREESPLIQMAKA

Seg: seg
21-30 seg

SVIVLISLIV

Seg: seg
34-47 seg

LHLLGKLLKRKHQK

Seg: seg
281-291 seg

LWLFVVLFLLL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox