PRGDB00077165 (Stu.3489)

From PRG Wiki
Jump to: navigation, search
Stu.3489
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 39804423 (CK251416)
Gene Class Unknown
Domain Type
Gene Species Solanum tuberosum

Comment?

EST735053 potato callus cDNA library, normalized and full-length Solanum tuberosum cDNA clone POCBN25 5' end, mRNA sequence

DNA Sequence

GATCGTCACCGGAGCCAACGGATTCATCGGTTCATGGGTGGTTCAGACGCTCCTCAACCGTGGCTACACCACCATCCACGCCGCCATCTTACCCGGTTCCGATCCTTCGCACCTCCACTCTCTCGCCGGCGCATCTAACCCCGGTGTGCGAATATTGGTTCACGAAGTCAACATCCTTGACGCCGATGCAGTCTCCAGAGCAATAGAAGGATGCGGCGGCGGCGGGGTTTTCCACGTGGCGTCGCCGTGTACGCTAGAGGATCCGGTGGACCCGCAGAAGGAGCTGGTTGAGCCTGCCGTACAGGGTACGATCAATGTGCTCACGGCGGCGAAGAGGTTTAATGTTCGGCGCGTGGTGCTCACTTCCTCCATTTCCGCCATGGTTCCCAATCCTGGTTGGTCGGAAAATAAGGTCTTCGATGAGTCGTCGTGGACTGATCTTGAGTACTGCAAGTCTCGCCAGAAATGGTACCCAGTCTCAAAGACACTTGCTGAGAAGGCTGCATGGGAGTTTGCGGAGAAGAATGGATTAGATGTGGTAGCAATTAATCCAGCTACATGTCTTGGTCAACTTCTGCAACCTGGACTGAATGCAAGCTGCGCTGTTTTGCAACAACTGCTTCAGGGATCAACAGATACCCAAGAGTATCATTGGTTAGGGGCTGTGCACGTCAAAGACGTGGCAGCGGCACAGATTTTGTTATTTGAGAGCCCTCGTGCTTCTGGAAGATACTTATGTACCAATGGCATTTACCAGTTTGGTGATTTTGCTGACAGAGTCTCAAAACTTTCCCCTGAATTCTCTGTCCACAGGTTCCCAGGGGAGACCCAGCCAGGCTTGGTGGCTTGCAAAGATGCTGCTAAAAAATTGATTGATTTGGGACTAATTTTCACCCCAGTTGAAGATGCAATTAAGGATACAGTGAATAGCCTTTTAAGCAAAGGCTTTACTCATTAATTATCCTGATCCCACACTTGCTTTTAGAAAATTCATCTTTTTTGCTTAGATGG


Protein sequences

Name Description Sequence
Stu.3489 translated coding region predicted by ESTScan from UniGene Stu.3489

XIVTGANGFIGSWVVQTLLNRGYTTIHAAILPGSDPSHLHSLAGASNPGVRILVHEVNILDADAVSRAIEGCGGGGVFHVASPCTLEDPVDPQKELVEPAVQGTINVLTAAKRFNVRRVVLTSSISAMVPNPGWSENKVFDESSWTDLEYCKSRQKWYPVSKTLAEKAAWEFAEKNGLDVVAINPATCLGQLLQPGLNASCAVLQQLLQGSTDTQEYHWLGAVHVKDVAAAQILLFESPRASGRYLCTNGIYQFGDFADRVSKLSPEFSVHRFPGETQPGLVACKDAAKKLIDLGLIFTPVEDAIKDTVNSLLSKGFTH

Domains

Domain Start-End Description Sequence

superfamily: SSF51735
2-314 NAD(P)-binding Rossmann-fold domains

IVTGANGFIGSWVVQTLLNRGYTTIHAAILPGSDPSHLHSLAGASNPGVRILVHEVNILDADAVSRAIEGCGGGGVFHVASPCTLEDPVDPQKELVEPAVQGTINVLTAAKRFNVRRVVLTSSISAMVPNPGWSENKVFDESSWTDLEYCKSRQKWYPVSKTLAEKAAWEFAEKNGLDVVAINPATCLGQLLQPGLNASCAVLQQLLQGSTDTQEYHWLGAVHVKDVAAAQILLFESPRASGRYLCTNGIYQFGDFADRVSKLSPEFSVHRFPGETQPGLVACKDAAKKLIDLGLIFTPVEDAIKDTVNSLLS

HMMPfam: PF01370
IPR001509
2-245 Epimerase
NAD-dependent epimerase/dehydratase

IVTGANGFIGSWVVQTLLNRGYTTIHAAILPGSDPSHLHSLAGASNPGVRILVHEVNILDADAVSRAIEGCGGGGVFHVASPCTLEDPVDPQKELVEPAVQGTINVLTAAKRFNVRRVVLTSSISAMVPNPGWSENKVFDESSWTDLEYCKSRQKWYPVSKTLAEKAAWEFAEKNGLDVVAINPATCLGQLLQPGLNASCAVLQQLLQGSTDTQEYHWLGAVHVKDVAAAQILLFESPRASGRY

Gene3D: G3DSA:3.40.50.720
IPR016040
2-214 no description
NAD(P)-binding domain

IVTGANGFIGSWVVQTLLNRGYTTIHAAILPGSDPSHLHSLAGASNPGVRILVHEVNILDADAVSRAIEGCGGGGVFHVASPCTLEDPVDPQKELVEPAVQGTINVLTAAKRFNVRRVVLTSSISAMVPNPGWSENKVFDESSWTDLEYCKSRQKWYPVSKTLAEKAAWEFAEKNGLDVVAINPATCLGQLLQPGLNASCAVLQQLLQGSTDT

HMMPanther: PTHR10366:SF9
3-317 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

VTGANGFIGSWVVQTLLNRGYTTIHAAILPGSDPSHLHSLAGASNPGVRILVHEVNILDADAVSRAIEGCGGGGVFHVASPCTLEDPVDPQKELVEPAVQGTINVLTAAKRFNVRRVVLTSSISAMVPNPGWSENKVFDESSWTDLEYCKSRQKWYPVSKTLAEKAAWEFAEKNGLDVVAINPATCLGQLLQPGLNASCAVLQQLLQGSTDTQEYHWLGAVHVKDVAAAQILLFESPRASGRYLCTNGIYQFGDFADRVSKLSPEFSVHRFPGETQPGLVACKDAAKKLIDLGLIFTPVEDAIKDTVNSLLSKGF

HMMPanther: PTHR10366
3-317 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

VTGANGFIGSWVVQTLLNRGYTTIHAAILPGSDPSHLHSLAGASNPGVRILVHEVNILDADAVSRAIEGCGGGGVFHVASPCTLEDPVDPQKELVEPAVQGTINVLTAAKRFNVRRVVLTSSISAMVPNPGWSENKVFDESSWTDLEYCKSRQKWYPVSKTLAEKAAWEFAEKNGLDVVAINPATCLGQLLQPGLNASCAVLQQLLQGSTDTQEYHWLGAVHVKDVAAAQILLFESPRASGRYLCTNGIYQFGDFADRVSKLSPEFSVHRFPGETQPGLVACKDAAKKLIDLGLIFTPVEDAIKDTVNSLLSKGF






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox