PRGDB00077174 (Stu.3933)

From PRG Wiki
Jump to: navigation, search
Stu.3933
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 62893347 (DN908584)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Solanum tuberosum

Comment?

25666.2 Developing Tubers Solanum tuberosum cDNA clone 25666 5', mRNA sequence

DNA Sequence

CCTCTGGACTGGGAAACCCGACTACGCATTGCCATTGGTGCAGCTAGAGGCATTGCTCAAATACATGGACAGTCTGGGGGAAGGCTTGTCCACGGGAACATAAAATCCTCAAACATATTCCTCAACTCCCAAGGTTTCGGTTGTATTTCTGATCTTGGCTTGGCAACTATAATGGGTCCAATTGCTACACCAATCGTGAGAGCTGCTGGTTATCAACCTCCAGAAGTTACAGATTCAAGAAAAGTATCTCAAACCACTGATGTCTACAGCTTTGGCGTCCTAATACTTGAACTTCTCACTGGAAAGTCACCTACACATGCCACAGGTACTAGCGACATTGTCCACTTAGTCAGGTGGGTACATTCTGTCGTTCGTGAGGAGTGGACTGCTGAAGTATTCGATGTGGAGCTTTTGAGGTATCCAAATATAGAAGAAGAAATGGTAGAGATGTTACAAATAGGTTTGACTTGTGTATCCAGAATGCCAGAGCAGAGACCAAAAATGACAGAAGTAGTAAAGATGGTAGAGGGTGTAGGAGAGTGAATACGGGGACTCGAACATCCACTGAAGCTTCTACACCGAACCTGACACCACCGATGACTGAAATAGGGTCGTCTTCCATTACACACTGATATTTCTTTGGTATTTAGTGATTAGGTTACTGTTCTATATGCTCAATTGTTTCATTGTTATAAGTTTTTTCCTCAACTTCTGTCAAAACATTATTTCAGCTACAAAATTGAATAGAAATATTTACTTGATCTTAAAAACAACACAACAAAAACTCAGGGGGGCCCGTACCAATTCCCTAATTATCGATAACGCGCTCACTGCCGTCGTTTACAACGTCTGATGGAAACCTGCGTTACAACTTAATTGTTGAAAATCCCTTGCCATGGTATACAAAAGCCACATTGCTTCACATGCGCTATGGAAGGACCTTATAGCATAACACGG


Protein sequences

Name Description Sequence
Stu.3933 translated coding region predicted by ESTScan from UniGene Stu.3933

PLDWETRLRIAIGAARGIAQIHGQSGGRLVHGNIKSSNIFLNSQGFGCISDLGLATIMGPIATPIVRAAGYQPPEVTDSRKVSQTTDVYSFGVLILELLTGKSPTHATGTSDIVHLVRWVHSVVREEWTAEVFDVELLRYPNIEEEMVEMLQIGLTCVSRMPEQRPKMTEVVKMVEGVGE

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-180 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

PLDWETRLRIAIGAARGIAQIHGQSGGRLVHGNIKSSNIFLNSQGFGCISDLGLATIMGPIATPIVRAAGYQPPEVTDSRKVSQTTDVYSFGVLILELLTGKSPTHATGTSDIVHLVRWVHSVVREEWTAEVFDVELLRYPNIEEEMVEMLQIGLTCVSRMPEQRPKMTEVVKMVEGVGE

HMMPanther: PTHR24420:SF850
1-178 SUBFAMILY NOT NAMED

PLDWETRLRIAIGAARGIAQIHGQSGGRLVHGNIKSSNIFLNSQGFGCISDLGLATIMGPIATPIVRAAGYQPPEVTDSRKVSQTTDVYSFGVLILELLTGKSPTHATGTSDIVHLVRWVHSVVREEWTAEVFDVELLRYPNIEEEMVEMLQIGLTCVSRMPEQRPKMTEVVKMVEGV

HMMPanther: PTHR24420
1-178 FAMILY NOT NAMED,FAMILY NOT NAMED

PLDWETRLRIAIGAARGIAQIHGQSGGRLVHGNIKSSNIFLNSQGFGCISDLGLATIMGPIATPIVRAAGYQPPEVTDSRKVSQTTDVYSFGVLILELLTGKSPTHATGTSDIVHLVRWVHSVVREEWTAEVFDVELLRYPNIEEEMVEMLQIGLTCVSRMPEQRPKMTEVVKMVEGV

superfamily: SSF56112
IPR011009
1-175 Protein kinase-like (PK-like)
Protein kinase-like domain

PLDWETRLRIAIGAARGIAQIHGQSGGRLVHGNIKSSNIFLNSQGFGCISDLGLATIMGPIATPIVRAAGYQPPEVTDSRKVSQTTDVYSFGVLILELLTGKSPTHATGTSDIVHLVRWVHSVVREEWTAEVFDVELLRYPNIEEEMVEMLQIGLTCVSRMPEQRPKMTEVVKMV

HMMPfam: PF00069
IPR017442
2-173 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

LDWETRLRIAIGAARGIAQIHGQSGGRLVHGNIKSSNIFLNSQGFGCISDLGLATIMGPIATPIVRAAGYQPPEVTDSRKVSQTTDVYSFGVLILELLTGKSPTHATGTSDIVHLVRWVHSVVREEWTAEVFDVELLRYPNIEEEMVEMLQIGLTCVSRMPEQRPKMTEVVK

Gene3D: G3DSA:1.10.510.10
2-176 no description

LDWETRLRIAIGAARGIAQIHGQSGGRLVHGNIKSSNIFLNSQGFGCISDLGLATIMGPIATPIVRAAGYQPPEVTDSRKVSQTTDVYSFGVLILELLTGKSPTHATGTSDIVHLVRWVHSVVREEWTAEVFDVELLRYPNIEEEMVEMLQIGLTCVSRMPEQRPKMTEVVKMVE

Seg: seg
9-21 seg

RIAIGAARGIAQI






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox