PRGDB00078029 (Ta.66090)

From PRG Wiki
Jump to: navigation, search
Ta.66090
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 20048227 (BJ228557)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Triticum aestivum

Comment?

BJ228557 Y. Ogihara unpublished cDNA library, Wh_dL Triticum aestivum cDNA clone whdl6p10 3', mRNA sequence

DNA Sequence

GGCCTTAACTGAATCTTAAGGTTAGCATAGTAGTAGCTTTCACAGCCTGTTTGGGGAGACCAAATTACAAGAGTACTGTAGCATACAAAGGAAAAACAATAGGCAGCTCAACTACCATGTAAAAAGGGAGATTTAACCAGAATCCAAACTAGCGGCTACATCATCTTTGGATTTGATTGTCCTGCAATAGCTTGAAGTAACCTTGGCACTGGAGGTGTCTCAACTTCAGACAGACACTCAAGAAACTGCACGACCTCACTCATTGTAGGACGATCAAACTCATCATCTTGAATACACCAACATGCGACTTTGCAAACTCTTTCAACCTCCTCCAGATTCGCTTCGCCCAACAATTTCGCATCCACCAGACTTGCAACGTCTCCCTCAACAAGACTGCGCGCAACTCGCACCGGAAAATATCCTTCATGAACACCGTCTTGGGAGGATGATTGCTTGCTCGACTTCCTGCTGCCCGATACGATCTCTAACAGAACCATCCCGTAGCTGTAAACGTCAACTTTCGACGTGATAGCAGTTCCGCTAATCCATTCAGGAGCAAGGTACCCAATGGTTCCCCTCATTGTGGTAACGACCTGGCTGAAATCCCTTCCCAAAAGTTTGGCCATTCCAAAGTCCGCAACCTTAGGAGTGAAAGACCCATCTAGGAGTATGTTCTCTGGCTTGATATCACAGTGTATAATGCAGTCCCGGCAACTTGAATGCAGAT


Protein sequences

Name Description Sequence
Ta.66090 translated coding region predicted by ESTScan from UniGene Ta.66090

XLHSSCRDCIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQFLECLSEVETPPVPRLLQAIAGQSNPKMM

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-166 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XLHSSCRDCIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQFLECL

HMMSmart: SM00220
IPR002290
1-163 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

XLHSSCRDCIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQFL

Gene3D: G3DSA:1.10.510.10
2-171 no description

LHSSCRDCIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQFLECLSEVET

HMMPanther: PTHR24420:SF442
2-179 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

LHSSCRDCIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQFLECLSEVETPPVPRLLQ

HMMPanther: PTHR24420
2-179 FAMILY NOT NAMED,FAMILY NOT NAMED

LHSSCRDCIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQFLECLSEVETPPVPRLLQ

superfamily: SSF56112
IPR011009
2-171 Protein kinase-like (PK-like)
Protein kinase-like domain

LHSSCRDCIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQFLECLSEVET

HMMPfam: PF00069
IPR017442
9-161 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

CIIHCDIKPENILLDGSFTPKVADFGMAKLLGRDFSQVVTTMRGTIGYLAPEWISGTAITSKVDVYSYGMVLLEIVSGSRKSSKQSSSQDGVHEGYFPVRVARSLVEGDVASLVDAKLLGEANLEEVERVCKVACWCIQDDEFDRPTMSEVVQ

PatternScan: PS00108
IPR008271
10-22 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IIHCDIKPENILL

Seg: seg
85-97 seg

SGSRKSSKQSSSQ






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox