PRGDB00078144 (Tcc.2941)

From PRG Wiki
Jump to: navigation, search
Tcc.2941
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 212313227 (CU534611)
Gene Class Unknown
Domain Type
Gene Species Theobroma cacao

Comment?

CU534611 TEGPULI_KZ0AAI_K Theobroma cacao cDNA clone KZ0AAK3YL14FM1, mRNA sequence

DNA Sequence

CGGGGATCCCGAACTTTCAACACTCCATCAACAGTCACTCAATCTCCAGTGCTGGAGCAGCGAAGATAATCGGTTTAGAGATGTCGACCCATGGGGAGGTAGTGTGCGTCACCGGAGCCAGCGGCAGCATTGGCTCTTGGCTCGTCAAACTCCTCCTGGCTCGCGGCTACACCGTCCACGGGACCGTCAAAAATCTCAGGGATGAGAAAGAAACGAAGCATCTGGAATCTTTAGAAGGAGCGGAGTCACGTCTCCGCCTCTTCCAGATCGATCTCCTCGATTATGATTCGATCGCCACCGCGATCAACGGCTGTGCTGGCGTCTTCCACCTCGCCTCTCCCTGCATCGTCGACCCAGTTCACGACCCTCAGAAGGAGCTTTTGGATCCTGCAATTAAAGGAACGCTCAATGTACTGACAGCTGCCAAAGAGCTCGGCGTTAAGCGCGTGGTCGTCACGTCTTCCATCTCCGCCATTACGCCCAGCCCGAACTGGCCAGCAGATAAGATCAAAGCAGAGGATTGTTGGTCTGATATCGAGTACTGCAAGCACAATGAATTATGGTATTCAATTTCTAAAACACTAGCTGAGAAGGCGGCATGGGAATTCTCCAAGGAGAAAGGTTTGGATGTGGTGGTGGTTAATCCAGGCACTGTGATGGGTCCTAATATTCCTCCAACCCTTAATGCTAGCATGTTTCTGTTGTTACGCCTTCTGCAAGGCTGCACAGACACATATCAGGACATTTTCATGGGATCTGTCC


Protein sequences

Name Description Sequence
Tcc.2941 translated coding region predicted by ESTScan from UniGene Tcc.2941

XGIPNFQHSINSHSISSAGAAKIIGLEMSTHGEVVCVTGASGSIGSWLVKLLLARGYTVHGTVKNLRDEKETKHLESLEGAESRLRLFQIDLLDYDSIATAINGCAGVFHLASPCIVDPVHDPQKELLDPAIKGTLNVLTAAKELGVKRVVVTSSISAITPSPNWPADKIKAEDCWSDIEYCKHNELWYSISKTLAEKAAWEFSKEKGLDVVVVNPGTVMGPNIPPTLNASMFLLLRLLQGCTDTYQDIFMGSVX

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR10366:SF9
17-254 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

SAGAAKIIGLEMSTHGEVVCVTGASGSIGSWLVKLLLARGYTVHGTVKNLRDEKETKHLESLEGAESRLRLFQIDLLDYDSIATAINGCAGVFHLASPCIVDPVHDPQKELLDPAIKGTLNVLTAAKELGVKRVVVTSSISAITPSPNWPADKIKAEDCWSDIEYCKHNELWYSISKTLAEKAAWEFSKEKGLDVVVVNPGTVMGPNIPPTLNASMFLLLRLLQGCTDTYQDIFMGSV

HMMPanther: PTHR10366
17-254 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

SAGAAKIIGLEMSTHGEVVCVTGASGSIGSWLVKLLLARGYTVHGTVKNLRDEKETKHLESLEGAESRLRLFQIDLLDYDSIATAINGCAGVFHLASPCIVDPVHDPQKELLDPAIKGTLNVLTAAKELGVKRVVVTSSISAITPSPNWPADKIKAEDCWSDIEYCKHNELWYSISKTLAEKAAWEFSKEKGLDVVVVNPGTVMGPNIPPTLNASMFLLLRLLQGCTDTYQDIFMGSV

superfamily: SSF51735
28-249 NAD(P)-binding Rossmann-fold domains

MSTHGEVVCVTGASGSIGSWLVKLLLARGYTVHGTVKNLRDEKETKHLESLEGAESRLRLFQIDLLDYDSIATAINGCAGVFHLASPCIVDPVHDPQKELLDPAIKGTLNVLTAAKELGVKRVVVTSSISAITPSPNWPADKIKAEDCWSDIEYCKHNELWYSISKTLAEKAAWEFSKEKGLDVVVVNPGTVMGPNIPPTLNASMFLLLRLLQGCTDTYQDI

Gene3D: G3DSA:3.40.50.720
IPR016040
34-241 no description
NAD(P)-binding domain

VVCVTGASGSIGSWLVKLLLARGYTVHGTVKNLRDEKETKHLESLEGAESRLRLFQIDLLDYDSIATAINGCAGVFHLASPCIVDPVHDPQKELLDPAIKGTLNVLTAAKELGVKRVVVTSSISAITPSPNWPADKIKAEDCWSDIEYCKHNELWYSISKTLAEKAAWEFSKEKGLDVVVVNPGTVMGPNIPPTLNASMFLLLRLLQG

HMMPfam: PF01370
IPR001509
35-230 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGASGSIGSWLVKLLLARGYTVHGTVKNLRDEKETKHLESLEGAESRLRLFQIDLLDYDSIATAINGCAGVFHLASPCIVDPVHDPQKELLDPAIKGTLNVLTAAKELGVKRVVVTSSISAITPSPNWPADKIKAEDCWSDIEYCKHNELWYSISKTLAEKAAWEFSKEKGLDVVVVNPGTVMGPNIPPTLNA






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox