PRGDB00078804 (Vvi.12930)

From PRG Wiki
Jump to: navigation, search
Vvi.12930
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 225468853 (XM_002266341)
Gene Class Mlo-like
Domain Type MLO
Gene Species Vitis vinifera

Comment?

PREDICTED: Vitis vinifera MLO5 protein (MLO5), mRNA

DNA Sequence

ATGTCTGGCGGTGGAGCCGAAGAAGAGACGACGTTGGAGTACACTCCCACATGGGTGGTGGCGGTTGTCTGCACCGTCATTGTCGCCATTTCTCTGGCCGTCGAGCGCTTTCTGCACTTTCTCGGCAAGTATTTGAAGAAGAAGAACCAGAATCCTCTGTTCCAGGCTTTGCAGAAGGTTAAGGAGGAGTTGATGCTTTTGGGGTTCATTTCCCTGCTGCTGACTGTGTTCCAGAACTTGATCACCAAATTTTGTGTGCCAAAGCATGTCGTGAGTCACCTGCTGCCTTGCAAGCTTCCGGAAGAAAAGCATGCCACTCAGAGTCTCTCGCACTGGGCACTTGGGAGGCATCTGCTCTCCTCTGCACCATCATCTTGCAGCAATGAGGTCAAAGTCCCATTTCTGTCTCTTGAAGCGTTGCATCATCTGCATATCTTCATCTTCGTGCTTGCCATTGTCCACGTGACCTTCTGTGTTCTCACTATTATCTTTGGAGGGGCAAAGATACATCAATGGAAACTTTGGGAGGATTCTATTGCAAAGGATAATTATGATACAGAAGAGGTTCTGAAGAAAAAGATCACCCATGTTCATGACCATGCATTCATCAAGGATCGTTTTCTTGGTATCGGTAAAAATTCAGCTGTCATGAGTTGGGTGCATTCATTTTTCAAGCAATTTTATGCATCTGTGACGAAATCAGATTACTTGACCTTACGACTAGGATTCATTATGATGCATTGCAGGCAAAACCGCAAGTTTAATTTTCACAAATACATGGTACGTGCCCTTGAAGACGATTTTAAGAAAGTTGTTGGTATAAGTTGGTATCTTTGGATCTTTGTGGTTGTCTTCTTGTTGCTTAATGTTGATGGTTGGCATACTTATTTCTGGATAGCATTCATTCCTTTCATTCTTCTACTTGCAGTGGGCGCTAAGCTGGAGCATGTCATTTCCCAGTTGGCCCATGAGGTTGCTGAGAAACATGCAGCCATAGAAGGAGAATTGGTTGTTCAACCTTCAGATGACCACTTCTGGTTCCATCGACCCCGAATTGTTCTTTTCCTGATCCATATTATTCTCTTCCAAAATTCATTTGAGATGGCATTTTTCTTCTGGATCTTGTTTACATATGGCTTTGATTCCTGTATAATGGGTAAAGTCCAATACATCATCCCAAGACTCGTTATAGGGGTGATCATTCAGGTACTCTGCAGCTATAGCACCCTCCCCCTTTATGCCATTGTCACCCAGATGGGGACTCATTTCAAAAAGGCGATATTTGATGAGCATGTGCAAGCAGGCCTTGTTGGTTGGGCTCAAAAGGCCAGGAAGAAAACAACGACTGGTAACGCTAACAGAGGACCCACGATTCAGCTTGGAAGAGTTGTGCGTAGTGAAAATGCGAAAGAGGAGATAACGCTTACAGGTGCCGCTGAGGAAAACAAGTAAGCAGCCAATCCAGAAAAAGATAGCAGGGTTCAGCCTTCTCTTATGTTGTCCTGTGAATTGTGTCATTTTGAACATGTTGTGTTCTTAAAAACATTGATTGAAATCGTTCCTGTTTTTGCCAATACTAGGTTGTAATGATCTGATTCTTAGAACTGTTAGCTCCCTTGGGTTTAAATCTCTTACAAAATACAAGGGTGTTTGCAGAGTTGAGTGGTGGTGTCTACTGATGAGCTGGTTTCATTTCTACATT


Protein sequences

Name Description Sequence
Vvi.12930 translated coding region predicted by ESTScan from UniGene Vvi.12930

MSGGGAEEETTLEYTPTWVVAVVCTVIVAISLAVERFLHFLGKYLKKKNQNPLFQALQKVKEELMLLGFISLLLTVFQNLITKFCVPKHVVSHLLPCKLPEEKHATQSLSHWALGRHLLSSAPSSCSNEVKVPFLSLEALHHLHIFIFVLAIVHVTFCVLTIIFGGAKIHQWKLWEDSIAKDNYDTEEVLKKKITHVHDHAFIKDRFLGIGKNSAVMSWVHSFFKQFYASVTKSDYLTLRLGFIMMHCRQNRKFNFHKYMVRALEDDFKKVVGISWYLWIFVVVFLLLNVDGWHTYFWIAFIPFILLLAVGAKLEHVISQLAHEVAEKHAAIEGELVVQPSDDHFWFHRPRIVLFLIHIILFQNSFEMAFFFWILFTYGFDSCIMGKVQYIIPRLVIGVIIQVLCSYSTLPLYAIVTQMGTHFKKAIFDEHVQAGLVGWAQKARKKTTTGNANRGPTIQLGRVVRSENAKEEITLTGAAEENK

Domains

Domain Start-End Description Sequence

HMMPfam: PF03094
IPR004326
8-454 Mlo
Mlo-related protein

EETTLEYTPTWVVAVVCTVIVAISLAVERFLHFLGKYLKKKNQNPLFQALQKVKEELMLLGFISLLLTVFQNLITKFCVPKHVVSHLLPCKLPEEKHATQSLSHWALGRHLLSSAPSSCSNEVKVPFLSLEALHHLHIFIFVLAIVHVTFCVLTIIFGGAKIHQWKLWEDSIAKDNYDTEEVLKKKITHVHDHAFIKDRFLGIGKNSAVMSWVHSFFKQFYASVTKSDYLTLRLGFIMMHCRQNRKFNFHKYMVRALEDDFKKVVGISWYLWIFVVVFLLLNVDGWHTYFWIAFIPFILLLAVGAKLEHVISQLAHEVAEKHAAIEGELVVQPSDDHFWFHRPRIVLFLIHIILFQNSFEMAFFFWILFTYGFDSCIMGKVQYIIPRLVIGVIIQVLCSYSTLPLYAIVTQMGTHFKKAIFDEHVQAGLVGWAQKARKKTTTGNANR

Seg: seg
19-30 seg

VVAVVCTVIVAI






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox