PRGDB00078987 (Vvi.21462)

From PRG Wiki
Jump to: navigation, search
Vvi.21462
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 225431101 (XM_002265484)
Gene Class Mlo-like
Domain Type MLO
Gene Species Vitis vinifera

Comment?

PREDICTED: Vitis vinifera MLO17 protein (MLO17), mRNA

DNA Sequence

ATGGAGGGGACGGAGGGAAGGGAAGATCGATCTTTGGCTGAAACCCCGACATGGGCGTTTGCAACTGTTGTTGCTGTCATGGTTGCTTTTGGGTTCTTCTTCCACTTTTCTTTGAAGCATTTTAAAAAGTGGTTGGAAAAGACCAAGAGGAAATCTCTACTCGCTGCTCTGGAGAAGATGAAGGACGAGCTAATGCTTTTTGGGCTTTTATCTCTGCTGATGGGTCATTGGACTCTTTTTGTGGCCAAGATTTGTGTTAAAACATCAGTTTTGAGCAGCCGATTCTATCCCTGTGTATTAGAAAGTGATATTAAACCCCTTGAGCACATTATCGTTTCAGATTCAAATTATTTTAATGACTCAGCTTTCCCAGATGAGCTGACTACCAGGCACAACTATTGTCCCAAGGGTCAAGAATCTTTTGCTTCATATGAAAGCCTTGAGCAGCTTCATCGTCTATTATTTGTTCTAGGTGTTATCCATGTCTCTTACAGCTTCGTTACCATTGCCCTGGCCATGATTAAGATTTATAGCTGGAGAAGATGGGAAGATCAAGCAAAGTCAATGGCCATTCAGGGCCTACAAGCTGCCCCGAACAGTATAAGAATGAGGCGACTATCTACTTTCATTTTTCACCATACATCCCATCCATGGAGCCAACATAGAGTTTTTGTTTGGTTGCTTTGTTTCAGCCGCCAGTTTTGGAGTTCTATAAATCGAGCAGACTACATGGCTTTGCGCTTGGGCTTCATAACTACACATGGACTTCATTTGTCATATGACTTCCATAACTATATGCTCCGAAGCATGGAGGAAGAATTTCGGGATATCGTTGGCATTAGTGTGCCTCTCTGGATTTATGCCATTTCATGCATTTTCCTAAATTTTCATGGAACCAATGTTTACTATTGGCTTTCCTTCCTTCCAGCAATTTTAATCCTGCTGGTTGGCACAAAGCTGCACCGCATAGTGGTAAAGTTGGCAGTTGAAATCATGGATACATCTCCACAGTTGGGAAATCATCAAGTAAAACTGAGGGATGAGCTCTTCTGGTTTGGGAGGCCCAAGCTCCTTCTGTGGTTAATACAATTGATATCATTCCAGAATGCATTTGAGATGTCAACATTCATCTGGTCACTGTGGGAAATTAGAGGACCTTCCTGTTTCATGGAGAATCGTAACTTTGCTGTTATCCGCTTGATATTTGGGGTTGTCTCCCAGTTTTGGTGTAGCTTTATCACATTCCCACTCTATGTTATCATTACACAGATGGGCTCCAGGTTCAAGAAAACTATAATGTCTGAAAATGTAAGAAAATCACTCCATGGATGGCAGAGGAGGGTAAAGGCCAGACACAGCGGTGCCCCTTTTCCACTCCTCACTGCAACATCAACATCATCCCTGTCATCCTTGTGCCCTTTAGAGGATGAGATGGACAGAACTGATCATGGTGCCTCAAGCAGCAAGGAGGGAAGCTACTCAATACTCGAAGACACCTCAACTCCATACCAACCAGTCTCTCTAGCACAAAGTCCAAGTTTTGAAGTCTCACCAAGCAACAAGTCACCGGTCCCATTGCATTGTGATCCAATCCATGACAGTTATCACAGTGACGAGGAGGAGGATCAAAAATGA


Protein sequences

Name Description Sequence
Vvi.21462 translated coding region predicted by ESTScan from UniGene Vvi.21462

MEGTEGREDRSLAETPTWAFATVVAVMVAFGFFFHFSLKHFKKWLEKTKRKSLLAALEKMKDELMLFGLLSLLMGHWTLFVAKICVKTSVLSSRFYPCVLESDIKPLEHIIVSDSNYFNDSAFPDELTTRHNYCPKGQESFASYESLEQLHRLLFVLGVIHVSYSFVTIALAMIKIYSWRRWEDQAKSMAIQGLQAAPNSIRMRRLSTFIFHHTSHPWSQHRVFVWLLCFSRQFWSSINRADYMALRLGFITTHGLHLSYDFHNYMLRSMEEEFRDIVGISVPLWIYAISCIFLNFHGTNVYYWLSFLPAILILLVGTKLHRIVVKLAVEIMDTSPQLGNHQVKLRDELFWFGRPKLLLWLIQLISFQNAFEMSTFIWSLWEIRGPSCFMENRNFAVIRLIFGVVSQFWCSFITFPLYVIITQMGSRFKKTIMSENVRKSLHGWQRRVKARHSGAPFPLLTATSTSSLSSLCPLEDEMDRTDHGASSSKEGSYSILEDTSTPYQPVSLAQSPSFEVSPSNKSPVPLHCDPIHDSYHSDEEEDQK

Domains

Domain Start-End Description Sequence

HMMPfam: PF03094
IPR004326
8-454 Mlo
Mlo-related protein

EDRSLAETPTWAFATVVAVMVAFGFFFHFSLKHFKKWLEKTKRKSLLAALEKMKDELMLFGLLSLLMGHWTLFVAKICVKTSVLSSRFYPCVLESDIKPLEHIIVSDSNYFNDSAFPDELTTRHNYCPKGQESFASYESLEQLHRLLFVLGVIHVSYSFVTIALAMIKIYSWRRWEDQAKSMAIQGLQAAPNSIRMRRLSTFIFHHTSHPWSQHRVFVWLLCFSRQFWSSINRADYMALRLGFITTHGLHLSYDFHNYMLRSMEEEFRDIVGISVPLWIYAISCIFLNFHGTNVYYWLSFLPAILILLVGTKLHRIVVKLAVEIMDTSPQLGNHQVKLRDELFWFGRPKLLLWLIQLISFQNAFEMSTFIWSLWEIRGPSCFMENRNFAVIRLIFGVVSQFWCSFITFPLYVIITQMGSRFKKTIMSENVRKSLHGWQRRVKARHSG

Seg: seg
19-43 seg

AFATVVAVMVAFGFFFHFSLKHFKK

Seg: seg
64-75 seg

LMLFGLLSLLMG

Seg: seg
459-471 seg

LLTATSTSSLSSL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox