PRGDB00079046 (Vvi.24309)

From PRG Wiki
Jump to: navigation, search
Vvi.24309
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 225448220 (XM_002266108)
Gene Class Mlo-like
Domain Type MLO
Gene Species Vitis vinifera

Comment?

PREDICTED: Vitis vinifera MLO16 protein (MLO16), mRNA

DNA Sequence

ATGATCAGCATTTTGAAGGACATCATGAACAATATGAAGGTGATGGAGGAAGAGAAAAATGTTGATTTGGAGGGAGAATGGAACGAAATCGAGGGGTTGATGGAGGTAGGAAGGTCTCTGGCGGAGACTCCAACCTGGGCAGTTGCATCAGTTGTCACTGTTATGGTTTTTGTTTGCTTTCTGGTTGAAAGATCCATTTACAGATTCGGGAAGTGGCTGAAGAAGACTAGGAGGAAGGCTCTGTTTTCTTCTCTGGAGAAGATTAAGGAAGAGCTGATGCTGCTTGGGCTCATATCTCTGATGTTGGGACAATGGGCAAGGTGGATTTCCGAGATTTGTGTAGATTCATCTCTTTTCAACAGCAAATTCTATCTTTGTTCCGAGCAAGATTTTAACATCAATGAGAATGTATGGTTTATGAAATCATTCTCATTTTCAAATGACACTAACATTCCCCCAAATGGAGCCAATGCCGTTCCATCTCATCAATGTGGTGAGGGCCGTGTACCGTTTGTTTCCCAAGAAGGTCTAGAGCAGCTTCACCGGTTTCTGTTTGTTCTTGGCATTACCCATGTCGTGTATAGTTGTATGGCGGTTGGTCTGTCCATGAGCAAGATTTACAGTTGGAGAAAGTGGGAAAATCAGGCAACCCTAGTTGCTGATGGGAGCTTGCAAGCAAAGGTAAACAAAGAGATGAGGAGACAATCCACCTTTGTTTTCCATCACACATCACACCCATGGAGCAGGAGCCGCATTCTCATTTGGATGCTTTGTTTTCTAAGACAATTCAAGAGGTCTATACAGAAATCTGATTACTTAGCACTGCGTTTGGGTTTCATCACTAATCACAAACTCCCGCTTTCTTATAATTTCCATAAGTATATGGTTCGGAGCATGGAAGATGAATTTCATGGAATTGTGGGGATTAGCTGGCCACTTTGGGGGTATGCCATAATCTGCATTTTCATAAATATTCATGGACTGAATATTTACTTCTGGCTTTCTTTCATTCCTGCCATTCTGATGGTGCTGGTTGGAACAAAGCTCCAGCATGTTGTCTCCTTGCTAGCTCTTGAAATTGGAGAACAACAAGGCCCACAGGTTGGAACTCAAGTAAAGCCACGGGATGAGCTGTTTTGGTTTGGAAAACCAGAAATATTGTTACGGTTGATACAATTTATCATATTTCAGAATGCCTTTGAGATGGCAACATTCATCTGGTCTTGGTGGGGATTTAAGCAGCAATCGTGCTTCATGAAGAACCATGTAACGATAATCATCCGATTGTCTTCTGGGGTTCTTGTTCAGTTCTGGTGTAGCTATTGCACTGTGCCTCTGAACGTAATTATCACACAGATGGGATCTCGATGCAAGAAAGCCTTAGTTGCTGAAAGTGTAAGAGAATCACTACACAGCTGGTGTAAGAGAGTCAAAGAGAAGTCTAGGCGCGACTCTATGAACTCCAGAGCTACACGGTCAGTCTGCTCACTTGAATCAACCATTGATGAGAGGGATGAGATCATCACAGTTGGATCAGGCACTCTAGGATCTGGTACCCTGTCTCGCTGTTCATCCTTAGGCTCACTGAATGAGGAAATCATAGTACCAACCCAACAGCTAGAGGGTGATTTTGAGAGCTCGGCCGCACCCCAGTATGACAATTCATTCAGGCATAGCTCATCACAATCAACCATCAATGTTGCAACCGATGATGTTGCAGATGAGGAGGAAGAAAAAGTGCAGACTCTTTTGGATTTGTTACAAAAGACATGA


Protein sequences

Name Description Sequence
Vvi.24309 translated coding region predicted by ESTScan from UniGene Vvi.24309

MISILKDIMNNMKVMEEEKNVDLEGEWNEIEGLMEVGRSLAETPTWAVASVVTVMVFVCFLVERSIYRFGKWLKKTRRKALFSSLEKIKEELMLLGLISLMLGQWARWISEICVDSSLFNSKFYLCSEQDFNINENVWFMKSFSFSNDTNIPPNGANAVPSHQCGEGRVPFVSQEGLEQLHRFLFVLGITHVVYSCMAVGLSMSKIYSWRKWENQATLVADGSLQAKVNKEMRRQSTFVFHHTSHPWSRSRILIWMLCFLRQFKRSIQKSDYLALRLGFITNHKLPLSYNFHKYMVRSMEDEFHGIVGISWPLWGYAIICIFINIHGLNIYFWLSFIPAILMVLVGTKLQHVVSLLALEIGEQQGPQVGTQVKPRDELFWFGKPEILLRLIQFIIFQNAFEMATFIWSWWGFKQQSCFMKNHVTIIIRLSSGVLVQFWCSYCTVPLNVIITQMGSRCKKALVAESVRESLHSWCKRVKEKSRRDSMNSRATRSVCSLESTIDERDEIITVGSGTLGSGTLSRCSSLGSLNEEIIVPTQQLEGDFESSAAPQYDNSFRHSSSQSTINVATDDVADEEEEKVQTLLDLLQKT

Domains

Domain Start-End Description Sequence

HMMPfam: PF03094
IPR004326
37-490 Mlo
Mlo-related protein

GRSLAETPTWAVASVVTVMVFVCFLVERSIYRFGKWLKKTRRKALFSSLEKIKEELMLLGLISLMLGQWARWISEICVDSSLFNSKFYLCSEQDFNINENVWFMKSFSFSNDTNIPPNGANAVPSHQCGEGRVPFVSQEGLEQLHRFLFVLGITHVVYSCMAVGLSMSKIYSWRKWENQATLVADGSLQAKVNKEMRRQSTFVFHHTSHPWSRSRILIWMLCFLRQFKRSIQKSDYLALRLGFITNHKLPLSYNFHKYMVRSMEDEFHGIVGISWPLWGYAIICIFINIHGLNIYFWLSFIPAILMVLVGTKLQHVVSLLALEIGEQQGPQVGTQVKPRDELFWFGKPEILLRLIQFIIFQNAFEMATFIWSWWGFKQQSCFMKNHVTIIIRLSSGVLVQFWCSYCTVPLNVIITQMGSRCKKALVAESVRESLHSWCKRVKEKSRRDSMNSRA

Seg: seg
48-62 seg

VASVVTVMVFVCFLV

Seg: seg
92-103 seg

LMLLGLISLMLG

Seg: seg
386-397 seg

ILLRLIQFIIFQ

Seg: seg
511-529 seg

GSGTLGSGTLSRCSSLGSL

Seg: seg
575-578 seg

EEEE






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox