PRGDB00080572 (Mgu.15127)

From PRG Wiki
Jump to: navigation, search
Mgu.15127
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 238212126 (GR085698)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Cucumis x hytivus

Comment?

CCIF17585.b1 CCIF Mimulus guttatus IM62 leaves (H) Mimulus guttatus cDNA clone CCIF17585 5', mRNA sequence

DNA Sequence

GAAGATTGCGTCTTGGTGCTGCTAGAGGTCTTGCATTTCTTCATAGTGACGAAGCTAAAGTAATCTATCGGGACTTCAAGACTTCTAATATTCTGCTCGATTCGAATTACAACGCAAAACTTTCCGATTTTGGATTGGCTAGAGACGGGCCCACTGGCGATAAGAGTCATGTCTCGACTAGAGTCATGGGAACTCACGGATATGCTGCACCGGAGTATCTATCCACAGGTCATTTAACTGCAAAGAGCGACGTGTACAGCTTCGGCGTAGTACTTGTGGAGATATTATGTGGTAAGAAAGCAATAGACAAGAATCGACCACCGGGCGAACATAACTTGGTGGAGTGGGCAAAGCCTTATTTGACCAATAAACGGAGGATTCTTCGAGTTTTGGATAATCGTTTAGAAGGACAGTATTCATTGGCTCATGCTGTGAAGGCAGCTCAGCTCGCTCTTCAGTGCTTATCCACAGAAGCCAGATCGAGGCCTAGTATGGATGAAGTGGTAACAGCTTTAGAGCAACTTCAAGACTCGAATACTAATATTCAAAAGAATCATCGGTTGAATAGACACGGTAAAACGAATAGCGGGCCTAATTCCGAGCCCAAGTCCCATAGAAGAAATGCGCAAGAAACACATAAAGTACAGGCTTACCCTAGACCAAAGTTGGTGTAGTGGTAAGAATTCTATTTGTGAAGATGTTCGATTGCTTGTTGTTTGTCTTGAAAATTCTTGTTAATTGTAGCTAAGAAACTTGGGTTATGATAATATTTGTTACTTAAGCTTGTTT


Protein sequences

Name Description Sequence
Mgu.15127 translated coding region predicted by ESTScan from UniGene Mgu.15127

XRLRLGAARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTALEQLQDSNTNIQKNHRLNRHGKTNSGPNSEPKSHRRNAQETHKVQAYPRPKLV

Domains

Domain Start-End Description Sequence

Seg: seg
1-12 seg

XRLRLGAARGLA

ProfileScan: PS50011
IPR000719
1-175 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XRLRLGAARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTALEQL

HMMSmart: SM00219
IPR020635
1-172 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

XRLRLGAARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTAL

superfamily: SSF56112
IPR011009
2-180 Protein kinase-like (PK-like)
Protein kinase-like domain

RLRLGAARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTALEQLQDSNT

HMMPanther: PTHR24420:SF861
2-190 SUBFAMILY NOT NAMED

RLRLGAARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTALEQLQDSNTNIQKNHRLNR

HMMPanther: PTHR24420
2-190 FAMILY NOT NAMED,FAMILY NOT NAMED

RLRLGAARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTALEQLQDSNTNIQKNHRLNR

HMMSmart: SM00220
IPR002290
2-175 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

RLRLGAARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTALEQL

Gene3D: G3DSA:1.10.510.10
7-214 no description

AARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVTALEQLQDSNTNIQKNHRLNRHGKTNSGPNSEPKSHRRNAQETHK

HMMPfam: PF00069
IPR017442
8-170 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

ARGLAFLHSDEAKVIYRDFKTSNILLDSNYNAKLSDFGLARDGPTGDKSHVSTRVMGTHGYAAPEYLSTGHLTAKSDVYSFGVVLVEILCGKKAIDKNRPPGEHNLVEWAKPYLTNKRRILRVLDNRLEGQYSLAHAVKAAQLALQCLSTEARSRPSMDEVVT

PatternScan: PS00108
IPR008271
21-33 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

VIYRDFKTSNILL

Coil: coil
165-186 coiled-coil

MDEVVTALEQLQDSNTNIQKNH






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox