PRGDB00080687 (Ptc.35)

From PRG Wiki
Jump to: navigation, search
Ptc.35
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 219111692 (XM_002177562)
Gene Class N
Domain Type NBS
Gene Species Dimocarpus longan

Comment?

Phaeodactylum tricornutum CCAP 1055

DNA Sequence

CACGGTTACGATCTCTAGAATTCCATCCTTCCCACATTTTCGAGGACTGTACTCGATCTCCGTTGCCTTGATCGACATCAACGTGTACTGCTCTCGGTTTATTTACGGTGCGTTGGTCTGAGATTGCAGCGTACTCTTTCCATATCTAAGAATCTACATTTGAAAGCACCGTTTCTGAAATCGCCTCCAACATGAACGATTCTTCGTCGTCCCGGACCGATCCCTTTGCCCCACGAGTCGGCAAACCACTGCTTTGGAGAAATGTGCAGATGAAGGCTACTGTGAACAAGAAGGACAGTGATGGTTCCAAGGTTATTCTGAAGGATGTGTGGGGGAGTATTCCAAATGGACGTGTGACTGCCATTATGGGGCCCTCCGGAGCGGGAAAGACGTCTCTTCTCAATATTTTGGCCGGTCGGGTCCAATCTTCCTCCAAGATTGAAATTGAAGCCGATATTCGCCTCGGGGACCAGCGTATTGACCCTTCACAACAAGCGGTGCGTCGCACCATGGCCTTTGTAGCTCAGGAAGAGTCTCTGCAAGTCACTAGTACCCCTCGTGAGGCGATTCGTTTCTCCGCTCGCATGCGCTTGCCGGTGGATCGGACCGACGAAGAAATTGACGAAATGACGAACCGTATGGTGAAAGAACTTGGGCTCGAGAAAGCCGCCGATACAGTCATTGGAGGAGCACTCTTGAAGGGAATCTCGGGTGGCGAGCGAAAGCGCACGGCAGTCGGTGTCGAGCTGGTTGTACAACCCACTTTGATCTTTTTGGATGAGCCCACGACGGGCTTGGACAGCTATTCGGCAATTGCGGTTGTTCAAATTCTCAAACGTGTTGCCACCTCTGGGTCGGCTGTCGCCTTGACGATACATCAACCCGCATCCGAAATCGTTCAACTTTTGGATGAGTTAATTTTGTTGCGATTGGGGAGTGTGTTGTATCAAGGTCCGGTCGCGGACATTCCGCGTGTTTTCGAGAATGCTGGTCTCCCACTCCCATCTCGTTACAATCCAGCTGACTGGATGTTGCACGTTGCCCAGACGATTACGACGGATAAACTTGCCGAAGGTCTGTACCCCAAAGATATCCGGGAATTTCCGCCTTTGCCTCCTCCATCCCGTTCTGGATCTACAGGCACGGGCGAAGGTAGGGGCAAGAAAGTTTCACAGTTATCTCAGATTGCAGCCTTGACAAAGCGAGAATTGATCAATTTGTACCGCTTTCCTGACGCGATCTTTATGCGCTGGGGTGGTGACACTATACTGGCGTTGCTCATTTCCTTGATCTACAAAAGTGTTGGCGAGACGGATCGATCGGTCCAGTCGAATATTCGCAGCATCTTCGGTGCCCTCGTATTCTCGCAATTGATGGGACTCTTTGGATGCGCCGAACCGAGTCTCATGTACTTTCCTCAAGATCGTCCAGTATTTTTGCGCGAGTATGCCACCAATCACTATTCTGTGACGTCCTACTTTCTGAGCCGAACCTTCATCGAGTCCGTCTTGGCCTTTGTGCAGATTACGGCTCAATCTCTTCTTTACGTCTACGTGATGGAACTAAACATACCATTCTGGGAATTTGTGGGAATCAACTACGTTTTGAGTATGGCCGGGACAGGTGTAGCAGTCTTTATCGGGTCCATTGTTGAAGACCCCAGGACAGCCACAGAGCTGCTTCCACTTGTATTGGTTCCGCAATTGCTTTTTGCTGGCTTTTTTGTGTCAATTGACAACATTCCCTCCTGGCTACAGTGGGCTCAGTATCTTTGCGCTTTGACGTACAGCATTCGCTTGGCGGTCATCGGGGAGTTCAGTTCCTGTGG


Protein sequences

Name Description Sequence
Ptc.35 translated coding region predicted by ESTScan from UniGene Ptc.35

XRLRSLEFHPSHIFEDCTRSPLPXSTSTCTALGLFTVRWSEIAAYSFHIXESTFESTVSEIASNMNDSSSSRTDPFAPRVGKPLLWRNVQMKATVNKKDSDGSKVILKDVWGSIPNGRVTAIMGPSGAGKTSLLNILAGRVQSSSKIEIEADIRLGDQRIDPSQQAVRRTMAFVAQEESLQVTSTPREAIRFSARMRLPVDRTDEEIDEMTNRMVKELGLEKAADTVIGGALLKGISGGERKRTAVGVELVVQPTLIFLDEPTTGLDSYSAIAVVQILKRVATSGSAVALTIHQPASEIVQLLDELILLRLGSVLYQGPVADIPRVFENAGLPLPSRYNPADWMLHVAQTITTDKLAEGLYPKDIREFPPLPPPSRSGSTGTGEGRGKKVSQLSQIAALTKRELINLYRFPDAIFMRWGGDTILALLISLIYKSVGETDRSVQSNIRSIFGALVFSQLMGLFGCAEPSLMYFPQDRPVFLREYATNHYSVTSYFLSRTFIESVLAFVQITAQSLLYVYVMELNIPFWEFVGINYVLSMAGTGVAVFIGSIVEDPRTATELLPLVLVPQLLFAGFFVSIDNIPSWLQWAQYLCALTYSIRLAVIGEFSSCG

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR19241
66-607 FAMILY NOT NAMED,ATP-BINDING CASSETTE TRANSPORTER

NDSSSSRTDPFAPRVGKPLLWRNVQMKATVNKKDSDGSKVILKDVWGSIPNGRVTAIMGPSGAGKTSLLNILAGRVQSSSKIEIEADIRLGDQRIDPSQQAVRRTMAFVAQEESLQVTSTPREAIRFSARMRLPVDRTDEEIDEMTNRMVKELGLEKAADTVIGGALLKGISGGERKRTAVGVELVVQPTLIFLDEPTTGLDSYSAIAVVQILKRVATSGSAVALTIHQPASEIVQLLDELILLRLGSVLYQGPVADIPRVFENAGLPLPSRYNPADWMLHVAQTITTDKLAEGLYPKDIREFPPLPPPSRSGSTGTGEGRGKKVSQLSQIAALTKRELINLYRFPDAIFMRWGGDTILALLISLIYKSVGETDRSVQSNIRSIFGALVFSQLMGLFGCAEPSLMYFPQDRPVFLREYATNHYSVTSYFLSRTFIESVLAFVQITAQSLLYVYVMELNIPFWEFVGINYVLSMAGTGVAVFIGSIVEDPRTATELLPLVLVPQLLFAGFFVSIDNIPSWLQWAQYLCALTYSIRLAVIGEFS

Gene3D: G3DSA:3.40.50.300
88-323 no description

NVQMKATVNKKDSDGSKVILKDVWGSIPNGRVTAIMGPSGAGKTSLLNILAGRVQSSSKIEIEADIRLGDQRIDPSQQAVRRTMAFVAQEESLQVTSTPREAIRFSARMRLPVDRTDEEIDEMTNRMVKELGLEKAADTVIGGALLKGISGGERKRTAVGVELVVQPTLIFLDEPTTGLDSYSAIAVVQILKRVATSGSAVALTIHQPASEIVQLLDELILLRLGSVLYQGPVADI

ProfileScan: PS50893
IPR003439
89-336 ABC_TRANSPORTER_2
ABC transporter-like

VQMKATVNKKDSDGSKVILKDVWGSIPNGRVTAIMGPSGAGKTSLLNILAGRVQSSSKIEIEADIRLGDQRIDPSQQAVRRTMAFVAQEESLQVTSTPREAIRFSARMRLPVDRTDEEIDEMTNRMVKELGLEKAADTVIGGALLKGISGGERKRTAVGVELVVQPTLIFLDEPTTGLDSYSAIAVVQILKRVATSGSAVALTIHQPASEIVQLLDELILLRLGSVLYQGPVADIPRVFENAGLPLPS

superfamily: SSF52540
96-322 P-loop containing nucleoside triphosphate hydrolases

NKKDSDGSKVILKDVWGSIPNGRVTAIMGPSGAGKTSLLNILAGRVQSSSKIEIEADIRLGDQRIDPSQQAVRRTMAFVAQEESLQVTSTPREAIRFSARMRLPVDRTDEEIDEMTNRMVKELGLEKAADTVIGGALLKGISGGERKRTAVGVELVVQPTLIFLDEPTTGLDSYSAIAVVQILKRVATSGSAVALTIHQPASEIVQLLDELILLRLGSVLYQGPVAD

HMMSmart: SM00382
IPR003593
116-321 ATPases associated with a variety of cellula,NBS
AAA+ ATPase domain

NGRVTAIMGPSGAGKTSLLNILAGRVQSSSKIEIEADIRLGDQRIDPSQQAVRRTMAFVAQEESLQVTSTPREAIRFSARMRLPVDRTDEEIDEMTNRMVKELGLEKAADTVIGGALLKGISGGERKRTAVGVELVVQPTLIFLDEPTTGLDSYSAIAVVQILKRVATSGSAVALTIHQPASEIVQLLDELILLRLGSVLYQGPVA

HMMPfam: PF00005
IPR003439
131-264 ABC_tran
ABC transporter-like

TSLLNILAGRVQSSSKIEIEADIRLGDQRIDPSQQAVRRTMAFVAQEESLQVTSTPREAIRFSARMRLPVDRTDEEIDEMTNRMVKELGLEKAADTVIGGALLKGISGGERKRTAVGVELVVQPTLIFLDEPTT

Seg: seg
369-387 seg

PPLPPPSRSGSTGTGEGRG

HMMPfam: PF01061
IPR013525
395-606 ABC2_membrane
ABC-2 type transporter

QIAALTKRELINLYRFPDAIFMRWGGDTILALLISLIYKSVGETDRSVQSNIRSIFGALVFSQLMGLFGCAEPSLMYFPQDRPVFLREYATNHYSVTSYFLSRTFIESVLAFVQITAQSLLYVYVMELNIPFWEFVGINYVLSMAGTGVAVFIGSIVEDPRTATELLPLVLVPQLLFAGFFVSIDNIPSWLQWAQYLCALTYSIRLAVIGEF

Seg: seg
560-570 seg

LLPLVLVPQLL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox