PRGDB00080688 (Ptc.137)

From PRG Wiki
Jump to: navigation, search
Ptc.137
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 219128297 (XM_002184317)
Gene Class RLP
Domain Type Ser-Thr Kinase, LRR
Gene Species Dimocarpus longan

Comment?

Phaeodactylum tricornutum CCAP 1055

DNA Sequence

GTTAGAGGAACTCACCCCCGTCCACACACAAACAACGCTTCTACAGGACGACAAAAACTCGGATTGTGACGCCAAGCACACCCTCACCAATTGAAGAGACTCACAGTCAAGCGTTGCCTTTGCTTCTTTTCTTGTAGCCCCCATCGCTACTGTTCATCATGTCCAACAGTCTTTACGATGACGGCTCGTACAATGCCTTCCGCGTCCCTTTCTACCGCACACGCAAGTTTTTCATCGGAGTCACTCTTTCGGTCATGCTACTGATTGCGATCGTTGCCGTGGTAGTTTCCGGGAACAAGGGATCCGAGTTTGCAGCGCTAGGAAATTCCTCCACCCCTCGTGTTCCGGAAATAGAAGTCTCGGAATCTACTCTTCAAGAAAACGAAGCGGAACTCGGAGCCGCCCTGATCCAACTTTACGATCGATTGGACATTCCGTGGAATGGACTATACGAAGACGCTACTCCTCAGGGCAGGGCCTTGCAAGCTGTGGCGGGTACAAAGCTCTACGCTTCGTTGGACCGCGTTCGTAGTGTCCAGCGCTACGCCCTCGGAGTCTTTTACTACTCTACCTTTGCGGTTGCGCATCCGTACTTGGAAGCCGAGGACACCCGTCCCTGGGGTTCCAGTGATTTCTGGATGAGCAGTACTCCCGAGTGTGAGTGGGAGGGCATCACGTGTGATGACAGTGGTCGTGTCGCAGCGATCGATTTGTCAAGCAACTATCTGTCCGGGACGCTTCCACTGGAACTTGCACTTTTGGACAAGCTTGTGGGTCTGAATCTGGCAAACAACTATATATTCGGGGAAGGTGCCAGCAACGACGTCTGGAGCTATTTGCCAAACCTACAGGACCTTATGATGGACGATAACTTTGTGATTGCCACCACGGGACTACCATCCCAAATGAAGAGCTTGGAATCGATTCAGAAGTTGTCTGTTTCTTACAATCTACTGCAGGGTGTTCTGGATGGCGAGATTATCGGCAATATGCAGCGTCTGTCACATCTGGAAGTGGAATCAAACTATATTTCTGGTGAACTTCCCGTGGAACTTGGAACTCTGCCCGATTTGGTCTACTTTTACATCCGCCGTAACAGTCTTTCGTTCAACTTGAACAAGCTCATCGTGCCGAACCGATTTCCAAAGATCTTCGCGTTGTGGCTCGACTCCAACCCTATTACGGGAACGATTCCTAGCGAGATTGGAACGCTGACCACACTCACATCCTTCAGCCTCACCAATGCCACTTTGACGGGGAAAATTCCCTCCGAAATGGGCAATTTGGCCAAAATGAAGCGTTGCTGGTTGTACGACAATGCGTTGACTGGGACAATCCCACAAGCTTTGTCGAGTTGGGTCGACTTGCAAGTTTTGGAAGTGTCTGGAAACAACTTTGTCGGAGACATGCCTCAAGGTGTGTGCGACGCCATTACGGCCTCAGACTACCAGTTCAAAACCTTATCAGCGGATTGTACCCGTATCGCCTGCGAAGGATGTTGTACGGAATGTGAAAACAGTTAAACGACATTTTTTTGGGTAGAAAGCAATACCCTTTTATATTTTAACACTTGAGATTATGTTTACTTTGTCTC


Protein sequences

Name Description Sequence
Ptc.137 translated coding region predicted by ESTScan from UniGene Ptc.137

XLEELTPVHTQTTLLQDDKNSDCDAKHTLTNXRDSQSSVAFASFLVAPIATVHHVQQLYDDGSYNAFRVPFYRTRKFFIGVTLSVMLLIAIVAVVVSGNKGSEFAALGNSSTPRVPEIEVSESTLQENEAELGAALIQLYDRLDIPWNGLYEDATPQGRALQAVAGTKLYASLDRVRSVQRYALGVFYYSTFAVAHPYLEAEDTRPWGSSDFWMSSTPECEWEGITCDDSGRVAAIDLSSNYLSGTLPLELALLDKLVGLNLANNYIFGEGASNDVWSYLPNLQDLMMDDNFVIATTGLPSQMKSLESIQKLSVSYNLLQGVLDGEIIGNMQRLSHLEVESNYISGELPVELGTLPDLVYFYIRRNSLSFNLNKLIVPNRFPKIFALWLDSNPITGTIPSEIGTLTTLTSFSLTNATLTGKIPSEMGNLAKMKRCWLYDNALTGTIPQALSSWVDLQVLEVSGNNFVGDMPQGVCDAITASDYQFKTLSADCTRIACEGCCTECENS

Domains

Domain Start-End Description Sequence

Seg: seg
84-97 seg

SVMLLIAIVAVVVS

superfamily: SSF52058
185-476 L domain-like,LRR

GVFYYSTFAVAHPYLEAEDTRPWGSSDFWMSSTPECEWEGITCDDSGRVAAIDLSSNYLSGTLPLELALLDKLVGLNLANNYIFGEGASNDVWSYLPNLQDLMMDDNFVIATTGLPSQMKSLESIQKLSVSYNLLQGVLDGEIIGNMQRLSHLEVESNYISGELPVELGTLPDLVYFYIRRNSLSFNLNKLIVPNRFPKIFALWLDSNPITGTIPSEIGTLTTLTSFSLTNATLTGKIPSEMGNLAKMKRCWLYDNALTGTIPQALSSWVDLQVLEVSGNNFVGDMPQGVCD

Gene3D: G3DSA:3.80.10.10
211-471 no description

DFWMSSTPECEWEGITCDDSGRVAAIDLSSNYLSGTLPLELALLDKLVGLNLANNYIFGEGASNDVWSYLPNLQDLMMDDNFVIATTGLPSQMKSLESIQKLSVSYNLLQGVLDGEIIGNMQRLSHLEVESNYISGELPVELGTLPDLVYFYIRRNSLSFNLNKLIVPNRFPKIFALWLDSNPITGTIPSEIGTLTTLTSFSLTNATLTGKIPSEMGNLAKMKRCWLYDNALTGTIPQALSSWVDLQVLEVSGNNFVGDMP

HMMPanther: PTHR24420
213-472 FAMILY NOT NAMED,FAMILY NOT NAMED

WMSSTPECEWEGITCDDSGRVAAIDLSSNYLSGTLPLELALLDKLVGLNLANNYIFGEGASNDVWSYLPNLQDLMMDDNFVIATTGLPSQMKSLESIQKLSVSYNLLQGVLDGEIIGNMQRLSHLEVESNYISGELPVELGTLPDLVYFYIRRNSLSFNLNKLIVPNRFPKIFALWLDSNPITGTIPSEIGTLTTLTSFSLTNATLTGKIPSEMGNLAKMKRCWLYDNALTGTIPQALSSWVDLQVLEVSGNNFVGDMPQ

HMMPanther: PTHR24420:SF474
213-472 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

WMSSTPECEWEGITCDDSGRVAAIDLSSNYLSGTLPLELALLDKLVGLNLANNYIFGEGASNDVWSYLPNLQDLMMDDNFVIATTGLPSQMKSLESIQKLSVSYNLLQGVLDGEIIGNMQRLSHLEVESNYISGELPVELGTLPDLVYFYIRRNSLSFNLNKLIVPNRFPKIFALWLDSNPITGTIPSEIGTLTTLTSFSLTNATLTGKIPSEMGNLAKMKRCWLYDNALTGTIPQALSSWVDLQVLEVSGNNFVGDMPQ

Seg: seg
404-419 seg

TLTTLTSFSLTNATLT






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox