PRGDB00080693 (Ptc.664)

From PRG Wiki
Jump to: navigation, search
Ptc.664
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 219130502 (XM_002185367)
Gene Class Unknown
Domain Type
Gene Species Dimocarpus longan

Comment?

Phaeodactylum tricornutum CCAP 1055

DNA Sequence

TTACTAGCAAACGTTCCGCGCTACCGTTGTTCGGGGTGTCTCTAGCCTGCATTGTATTGTTGCAGCATAAACTAGCCAGGTAATATTCCGAGCTTAGAGTAATATCAATATGCCTTGTACGAAACCGTTGAACATTGACACGTCCCAACCCGTTTTGGTGACGGGTGCAACTGGCTACGTTGCCGGCGTCTTGATCCAGCAGCTATTGGAAGCCGGCGTGACGGTCCACGCCACGGTCCGCGATCCTTCGCAGACGGAACGCGTACAATACCTGCAAGATCTCGCGGACCAGAGCGGTTCCGGAACGATCCGATTCTTTCGGGGAGATCTCTTGCAGGAAGATAGCTTTGACGAAGGCATGAAAGGATGCGGAATTGTCTTTCATACGGCATCACCTTTCCAGTTGGACTACAAGGACGCGTACCACGATCTCGTCCAACCAGCCGTCCGGGGAACGCAAATTGTTTTCCACACGGCATCTCGGACGCCGTCGGTAAAGCGGGTTGTCTTGACCTCCTCCTGTGTCGCCATTTACACCGACATTTCCGAATGTGACGCTGTCAACAACAAGTCACTCAACGAAGAGACCTGGAATCGCACTGCCTCTCTCGATTATCAGCCCTATTCCTTGAGCAAGACGCTGGCGGAACAAAAAGCCTGGGAGATTGCCGGAAGTCAAACGGCCTGGAAATTGGTAACGATCAATCCATCCCTAGTCTTTGGTCCGGGAGTCAAGTACCACGAATCGTCCACTTCCTTTTCCCTGATGAAACAGCTCGGGGACGGTTCCATGCCGCTCTGTCCCAATATGGGCATGGGTATGGTGGATGTTCGAGATGTGGCGGCGGCGCACATTGCGGCCGCCTATCTCCCCGAAGCCTCCGGCCGTCACGTTTTGTCCGGACACAATAGCAGCCTCTTGACCATGGCGCGACTTTTGAGTCCGAAATTCCCGGATTACCCCGTTCCGACCAGGGCCGTGCCAAAACCGCTGCTCTGGTTGCTGGCGCCGTATTTACCGGGAGGCATGTCGCGTCGGTACGTTTGGAACAATATCAATGTGGAAGCTAGCTTCGATCATACCAAGTCGGTGAGCCAACTAGGTATTCAATATCGTCCCTTGGACGAAACAGGTGCGGACATGTTCCAACAGCTTGTCGATCTTGGCGTCCTCACGAAGAAGTAGCGGAGGAATAGCTGGTCGTACGCGATCCATTCTTTGCGGAAAAGATTTGAAATTTTAGTGTTTGATGGAGAGCCGTAAAAAAGACCGTAATTTTCTAGATGTAGGTTTTACTACCTGGTT


Protein sequences

Name Description Sequence
Ptc.664 translated coding region predicted by ESTScan from UniGene Ptc.664

MPCTKPLNIDTSQPVLVTGATGYVAGVLIQQLLEAGVTVHATVRDPSQTERVQYLQDLADQSGSGTIRFFRGDLLQEDSFDEGMKGCGIVFHTASPFQLDYKDAYHDLVQPAVRGTQIVFHTASRTPSVKRVVLTSSCVAIYTDISECDAVNNKSLNEETWNRTASLDYQPYSLSKTLAEQKAWEIAGSQTAWKLVTINPSLVFGPGVKYHESSTSFSLMKQLGDGSMPLCPNMGMGMVDVRDVAAAHIAAAYLPEASGRHVLSGHNSSLLTMARLLSPKFPDYPVPTRAVPKPLLWLLAPYLPGGMSRRYVWNNINVEASFDHTKSVSQLGIQYRPLDETGADMFQQLVDLGVLTKKXRRNSWSYAIHSLRKRFEILVFDGEP

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR10366
1-374 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

MPCTKPLNIDTSQPVLVTGATGYVAGVLIQQLLEAGVTVHATVRDPSQTERVQYLQDLADQSGSGTIRFFRGDLLQEDSFDEGMKGCGIVFHTASPFQLDYKDAYHDLVQPAVRGTQIVFHTASRTPSVKRVVLTSSCVAIYTDISECDAVNNKSLNEETWNRTASLDYQPYSLSKTLAEQKAWEIAGSQTAWKLVTINPSLVFGPGVKYHESSTSFSLMKQLGDGSMPLCPNMGMGMVDVRDVAAAHIAAAYLPEASGRHVLSGHNSSLLTMARLLSPKFPDYPVPTRAVPKPLLWLLAPYLPGGMSRRYVWNNINVEASFDHTKSVSQLGIQYRPLDETGADMFQQLVDLGVLTKKXRRNSWSYAIHSLRKR

HMMPanther: PTHR10366:SF10
1-374 NAD DEPENDENT EPIMERASE/DEHYDRATASE,NAD DEPENDENT EPIMERASE/DEHYDRATASE

MPCTKPLNIDTSQPVLVTGATGYVAGVLIQQLLEAGVTVHATVRDPSQTERVQYLQDLADQSGSGTIRFFRGDLLQEDSFDEGMKGCGIVFHTASPFQLDYKDAYHDLVQPAVRGTQIVFHTASRTPSVKRVVLTSSCVAIYTDISECDAVNNKSLNEETWNRTASLDYQPYSLSKTLAEQKAWEIAGSQTAWKLVTINPSLVFGPGVKYHESSTSFSLMKQLGDGSMPLCPNMGMGMVDVRDVAAAHIAAAYLPEASGRHVLSGHNSSLLTMARLLSPKFPDYPVPTRAVPKPLLWLLAPYLPGGMSRRYVWNNINVEASFDHTKSVSQLGIQYRPLDETGADMFQQLVDLGVLTKKXRRNSWSYAIHSLRKR

superfamily: SSF51735
13-351 NAD(P)-binding Rossmann-fold domains

QPVLVTGATGYVAGVLIQQLLEAGVTVHATVRDPSQTERVQYLQDLADQSGSGTIRFFRGDLLQEDSFDEGMKGCGIVFHTASPFQLDYKDAYHDLVQPAVRGTQIVFHTASRTPSVKRVVLTSSCVAIYTDISECDAVNNKSLNEETWNRTASLDYQPYSLSKTLAEQKAWEIAGSQTAWKLVTINPSLVFGPGVKYHESSTSFSLMKQLGDGSMPLCPNMGMGMVDVRDVAAAHIAAAYLPEASGRHVLSGHNSSLLTMARLLSPKFPDYPVPTRAVPKPLLWLLAPYLPGGMSRRYVWNNINVEASFDHTKSVSQLGIQYRPLDETGADMFQQLVD

Gene3D: G3DSA:3.40.50.720
IPR016040
13-278 no description
NAD(P)-binding domain

QPVLVTGATGYVAGVLIQQLLEAGVTVHATVRDPSQTERVQYLQDLADQSGSGTIRFFRGDLLQEDSFDEGMKGCGIVFHTASPFQLDYKDAYHDLVQPAVRGTQIVFHTASRTPSVKRVVLTSSCVAIYTDISECDAVNNKSLNEETWNRTASLDYQPYSLSKTLAEQKAWEIAGSQTAWKLVTINPSLVFGPGVKYHESSTSFSLMKQLGDGSMPLCPNMGMGMVDVRDVAAAHIAAAYLPEASGRHVLSGHNSSLLTMARLLS

HMMPfam: PF01073
IPR002225
16-252 3Beta_HSD
3-beta hydroxysteroid dehydrogenase/isomerase

LVTGATGYVAGVLIQQLLEAGVTVHATVRDPSQTERVQYLQDLADQSGSGTIRFFRGDLLQEDSFDEGMKGCGIVFHTASPFQLDYKDAYHDLVQPAVRGTQIVFHTASRTPSVKRVVLTSSCVAIYTDISECDAVNNKSLNEETWNRTASLDYQPYSLSKTLAEQKAWEIAGSQTAWKLVTINPSLVFGPGVKYHESSTSFSLMKQLGDGSMPLCPNMGMGMVDVRDVAAAHIAAA

Seg: seg
245-252 seg

AAAHIAAA






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox