PRGDB00080699 (Ptc.1431)

From PRG Wiki
Jump to: navigation, search
Ptc.1431
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 219128295 (XM_002184316)
Gene Class RLP
Domain Type Ser-Thr Kinase, LRR
Gene Species Dimocarpus longan

Comment?

Phaeodactylum tricornutum CCAP 1055

DNA Sequence

AAAGAATCTCTCATCGTTGCATCAAGCGTCGCAAAAGAACCATAAGTGGCTCCTTGCCTTGCCTTGCCTATCCATCATGTCTCGTAATCTATACTATGACAGATCTTACAATGCTTTCCGCGTCCCTTTCTACCGTACTCGCAGATTTATATTCGGGGTAACTCTTTCGGCAATGCTACTGATTGCGATTGTAGCCGTGGTGGTCACCAGGCAAAGCAGATCGGAAGTTTTTGTGCCAGAAAGCTTGTCCGGTCCTCGTGTTCCTGAAGTTGAAGTCTCTGGCTCTACCCTTCAAGATAACGAGGCTGAACTCGTAGCCATACTGATCAGACGTTATGATCAGTTGGGTCTTTCTTGGAGGGGATTGTACGACGTCACAGCTCCCCAGGGCAAAGCTTTGCAAGCTGTTGCGGGTACAACTCTTTACTCTTCGTTATTCCACCTTCGTAGCATCCAGCGCTTTGCCCTTGGGGTCTTTTACTATTCCACATTTGCAGTTTCGCATCCGTACTTGGAAGCTGAGGCCACTCGTCCCTGGGGCTCCAGCGACTTCTGGATGACCAGTACTCCCGAGTGTGAATGGAAAGGCATCACGTGCGATGCTAGTGGTCTCGTTGTAGCGATTAACTTGTTAGGCAATAATCTGTCCGGATCACTTCCACTGGAACTTGCTCTCTTGGACAAATTGGTGAGCTTGAATCTGGCAAACAACGATATATATGGGGAAGAGGCCAGCAACGACGTCTGGAGCTATTTGCCAAACCTACAGGAGCTCATAATGGACGATAACTATGTTATAGCTACCACAGGGCTACCAACTCAAATGAAGAGCTTGGTAGCAATTCAGAAGTTATCCGTTTCCTACAATCTGCTGAGGGGTATTCTGGATGGTGAGATTATCGGCAATATGCAGCGCCTGACGCATCTGGAAATTGAATCGAACCGCATTTCTGGCGAACTCCCCGCAGAACTTGGAGGTCTGCCCAACTTAGAGTCTTTTTACATTCGCCAAAATAGCCTTTCATTCGACTTGAACAACCTGATCATGCTTAACCGATGGCCAAATGCACGAGCGTTGTGGCTCGATCACAACCCTATTACCGGAACGATTCCTCCCGAGCTTGGTACTTTGACAACACTTACATCTTTCAGCCTTACCAATTCCACTCTAAGGGGAAGTATTCCCACCGAAATGGGCAATCTGGTCAATTTGAGGCGCTGCTGGTTATATAACAATGCATTGACTGGCACCATCCCGGAAGCTTTGTCGGGTTGGGTTGACTTGCAAGTCTTAGAGGTGTATGGAAATAATTTGGTTGGAGACATGCCTCAAGGTATATGTGACACGATTGCGGCCTCGGACTACCAGTTCAAAAACTTGTCAGCTGATTGCACCCGTGTAGCCTGCGGTGGATGTTGTACGGATTGCCAGAATAGTTAATATAATCCAATTGTTTGCCAGAATGAA


Protein sequences

Name Description Sequence
Ptc.1431 translated coding region predicted by ESTScan from UniGene Ptc.1431

XKNLSSLHQASQKNHKWLLALPCLSIMSRNLYYDRSYNAFRVPFYRTRRFIFGVTLSAMLLIAIVAVVVTRQSRSEVFVPESLSGPRVPEVEVSGSTLQDNEAELVAILIRRYDQLGLSWRGLYDVTAPQGKALQAVAGTTLYSSLFHLRSIQRFALGVFYYSTFAVSHPYLEAEATRPWGSSDFWMTSTPECEWKGITCDASGLVVAINLLGNNLSGSLPLELALLDKLVSLNLANNDIYGEEASNDVWSYLPNLQELIMDDNYVIATTGLPTQMKSLVAIQKLSVSYNLLRGILDGEIIGNMQRLTHLEIESNRISGELPAELGGLPNLESFYIRQNSLSFDLNNLIMLNRWPNARALWLDHNPITGTIPPELGTLTTLTSFSLTNSTLRGSIPTEMGNLVNLRRCWLYNNALTGTIPEALSGWVDLQVLEVYGNNLVGDMPQGICDTIAASDYQFKNLSADCTRVACGGCCTDCQNS

Domains

Domain Start-End Description Sequence

Seg: seg
60-69 seg

LLIAIVAVVV

superfamily: SSF52058
158-449 L domain-like,LRR

GVFYYSTFAVSHPYLEAEATRPWGSSDFWMTSTPECEWKGITCDASGLVVAINLLGNNLSGSLPLELALLDKLVSLNLANNDIYGEEASNDVWSYLPNLQELIMDDNYVIATTGLPTQMKSLVAIQKLSVSYNLLRGILDGEIIGNMQRLTHLEIESNRISGELPAELGGLPNLESFYIRQNSLSFDLNNLIMLNRWPNARALWLDHNPITGTIPPELGTLTTLTSFSLTNSTLRGSIPTEMGNLVNLRRCWLYNNALTGTIPEALSGWVDLQVLEVYGNNLVGDMPQGICD

Gene3D: G3DSA:3.80.10.10
184-447 no description

DFWMTSTPECEWKGITCDASGLVVAINLLGNNLSGSLPLELALLDKLVSLNLANNDIYGEEASNDVWSYLPNLQELIMDDNYVIATTGLPTQMKSLVAIQKLSVSYNLLRGILDGEIIGNMQRLTHLEIESNRISGELPAELGGLPNLESFYIRQNSLSFDLNNLIMLNRWPNARALWLDHNPITGTIPPELGTLTTLTSFSLTNSTLRGSIPTEMGNLVNLRRCWLYNNALTGTIPEALSGWVDLQVLEVYGNNLVGDMPQGI

HMMPanther: PTHR24420
193-450 FAMILY NOT NAMED,FAMILY NOT NAMED

CEWKGITCDASGLVVAINLLGNNLSGSLPLELALLDKLVSLNLANNDIYGEEASNDVWSYLPNLQELIMDDNYVIATTGLPTQMKSLVAIQKLSVSYNLLRGILDGEIIGNMQRLTHLEIESNRISGELPAELGGLPNLESFYIRQNSLSFDLNNLIMLNRWPNARALWLDHNPITGTIPPELGTLTTLTSFSLTNSTLRGSIPTEMGNLVNLRRCWLYNNALTGTIPEALSGWVDLQVLEVYGNNLVGDMPQGICDT

Seg: seg
210-227 seg

NLLGNNLSGSLPLELALL

Seg: seg
375-391 seg

LGTLTTLTSFSLTNSTL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox