PRGDB00080700 (Ptc.1485)

From PRG Wiki
Jump to: navigation, search
Ptc.1485
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 219112314 (XM_002177873)
Gene Class N
Domain Type NBS
Gene Species Dimocarpus longan

Comment?

Phaeodactylum tricornutum CCAP 1055

DNA Sequence

AACTCATAGTTACATCGACTCGATTGGTGACTCTACCTGTCTTTCTACGTTTGGCTTCTTCAGTTTGGCAACAATCTTCGTTAGCTATCTATCTATCATCATCATGCAAGCCGATAAACCGATGGAACCGACCGTGGAGCAGGGTCAGCCGAATCACAGAGACTTTGGCAATCTGAAAGAATTCAAAGTCCAACATTCGACTCTCCGGGATGATCCTTTTGCCATTCGTCCGGGCAAGACGTTGCTGTGGACCGGCGTTAGTATGACACTACAGCCTTCCAAGAAAAAGGAAGAGCCGCGAGCTTTGCTCAAGAACGTTTGGGGCGAAGTTCCCGCGGGGAAAGTCACGGCAATCTTGGGTCCGTCGGGTGCCGGCAAGACGAGCCTTTTGAACATTTTGGCGGGCCGGACAATTTCTAGTTCCAACCTTACCGTCACTCATAACGTCCGTGTCGACACGTTTCAGGTGGACCCAGCCCGTCAATCCATGCGACGTCAGATTGCCTTTGTCGCCCAGGAGGACAGTCTCCCTGCCGCCACCACGCCCCGCGAAGCCATTCGCTTTTCCGCACGCCTGCGCCTCTCCAAGGACACCACCGACGAAGAACTGGAAACTCTCACCAACCGCATGCTACAGGAACTCGGACTAGAAGCCGCCGCAGATACCATCGTTGGCAACGCATTGATTAAAGGAATATCGGGTGGCGAGCGTAAACGCGCATCGGTGGGGGTGGAATTGGTCACTCGACCAGCGCTCGTGTTTTTGGACGAACCCACCTCCGGTTTGGATAGTTTTGCCGCTGTCAAGTTGGTTAACTTGTTGAAAAAGGTGGCATCGGCGGGTTCGTCTGTCCTATTCACCGTTCACCAACCAGCTTCGGAAACTTTCGCGAGTCTGGATCAGGTCATATTCATGGCGCATGGGCAAGTCGTTTACCAAGGGTCTCCCGAGAAAGTGCCGGAATACATGGAAGATCGAAACAAGTCGGTACCAGAACACGCCAACCCCGCCGATTGGATGTTGATGGTGACCCAGACGATGAGCGAAGACGAACTGGCAAAGGACAATTTCTTTTCGGTTGACGAACGGAATTTACCCGAAGCCGAACCAATGCCGAAAGGCCAAAGCATGATGGCCAAAACTATGCACTCGGAATCAGGGGCGATTGTGGAAGTTCAGAAAATCTCCATTTTTGTTCAGATTTATGAACTTCTATATCGCGATATCGTCAACACTGGTCGCGATACGACAGCTCTTTTGACTCGTTTTGGGGCATCCATCTTTTTGGGATTGGTGATCGGGGTCGTCTACCAGGGTGTCGGTGCAACTGACTTGTCCGACGCGATTGACCTCCAGAGCCATTTTGGAGGAATGACCATGGTTTTGATTCAGGCCATGTTTGGTACAGGAATTTCCATTCTGCTCGAGTTCCCTACCGAACGTCCCGTGTTCTTGCGAGAGTATACCACAGATCACTACCACATTGGGGCCTACATCTTTGCTAAGTTTGTCATGGAGGCGGTGTTGACGTTTCTCAAGGTCATGTGTGAAGCCTTGATTCTTTACTATCTGATGGAATTACAGATGCCCTTTTTGACTTACTTTGGAATCCTGTACATGCTCGCCATGGCCAGTGCGGCAATTGCGGTGCTCTTTGGCTCGGCCATGGACGATCAAAAGGTAGCCCAGGAAAGTTTGCCTATCCTTTACGTTCCACAGTTTCTGTTTTCGGGATTCTTCATAAGTATAACGCTCATCCCTCCTTACTTGCGTTGGGCGCAATACCTGTGCTCGCTGACCTACGCCATTCGCCTATCGGTGGTGAACGAGTTCGACAACTGCGTGGGACCGGACGCGCAGCAGAACTGCAACGATCTGTTTGAAGAATTGCAAGTGGATCGGTCTGACGTATGGTGGTACTGGCTAATGATTACCGTCATCTTTCTGATACCACGAATCGGAGCCATGTTCGCACTAAAGCAGTCAGCCAAGCGGTTTTATTCGAACTAACATTTTAAGAGAATCCTTATGGAAGGACCGACCTTGGTATCCGAGGACTACTCCATTATTTAAATGTTGTGCGTATTTGTGT


Protein sequences

Name Description Sequence
Ptc.1485 translated coding region predicted by ESTScan from UniGene Ptc.1485

XTHSYIDSIGDSTCLSTFGFFSLATIFVSYLSIIIMQADKPMEPTVEQGQPNHRDFGNLKEFKVQHSTLRDDPFAIRPGKTLLWTGVSMTLQPSKKKEEPRALLKNVWGEVPAGKVTAILGPSGAGKTSLLNILAGRTISSSNLTVTHNVRVDTFQVDPARQSMRRQIAFVAQEDSLPAATTPREAIRFSARLRLSKDTTDEELETLTNRMLQELGLEAAADTIVGNALIKGISGGERKRASVGVELVTRPALVFLDEPTSGLDSFAAVKLVNLLKKVASAGSSVLFTVHQPASETFASLDQVIFMAHGQVVYQGSPEKVPEYMEDRNKSVPEHANPADWMLMVTQTMSEDELAKDNFFSVDERNLPEAEPMPKGQSMMAKTMHSESGAIVEVQKISIFVQIYELLYRDIVNTGRDTTALLTRFGASIFLGLVIGVVYQGVGATDLSDAIDLQSHFGGMTMVLIQAMFGTGISILLEFPTERPVFLREYTTDHYHIGAYIFAKFVMEAVLTFLKVMCEALILYYLMELQMPFLTYFGILYMLAMASAAIAVLFGSAMDDQKVAQESLPILYVPQFLFSGFFISITLIPPYLRWAQYLCSLTYAIRLSVVNEFDNCVGPDAQQNCNDLFEELQVDRSDVWWYWLMITVIFLIPRIGAMFALKQSAKRFYSN

Domains

Domain Start-End Description Sequence

superfamily: SSF52540
89-337 P-loop containing nucleoside triphosphate hydrolases

MTLQPSKKKEEPRALLKNVWGEVPAGKVTAILGPSGAGKTSLLNILAGRTISSSNLTVTHNVRVDTFQVDPARQSMRRQIAFVAQEDSLPAATTPREAIRFSARLRLSKDTTDEELETLTNRMLQELGLEAAADTIVGNALIKGISGGERKRASVGVELVTRPALVFLDEPTSGLDSFAAVKLVNLLKKVASAGSSVLFTVHQPASETFASLDQVIFMAHGQVVYQGSPEKVPEYMEDRNKSVPEHANP

ProfileScan: PS50893
IPR003439
89-333 ABC_TRANSPORTER_2
ABC transporter-like

MTLQPSKKKEEPRALLKNVWGEVPAGKVTAILGPSGAGKTSLLNILAGRTISSSNLTVTHNVRVDTFQVDPARQSMRRQIAFVAQEDSLPAATTPREAIRFSARLRLSKDTTDEELETLTNRMLQELGLEAAADTIVGNALIKGISGGERKRASVGVELVTRPALVFLDEPTSGLDSFAAVKLVNLLKKVASAGSSVLFTVHQPASETFASLDQVIFMAHGQVVYQGSPEKVPEYMEDRNKSVPE

Gene3D: G3DSA:3.40.50.300
99-320 no description

EPRALLKNVWGEVPAGKVTAILGPSGAGKTSLLNILAGRTISSSNLTVTHNVRVDTFQVDPARQSMRRQIAFVAQEDSLPAATTPREAIRFSARLRLSKDTTDEELETLTNRMLQELGLEAAADTIVGNALIKGISGGERKRASVGVELVTRPALVFLDEPTSGLDSFAAVKLVNLLKKVASAGSSVLFTVHQPASETFASLDQVIFMAHGQVVYQGSPEKV

HMMPanther: PTHR19241
99-661 FAMILY NOT NAMED,ATP-BINDING CASSETTE TRANSPORTER

EPRALLKNVWGEVPAGKVTAILGPSGAGKTSLLNILAGRTISSSNLTVTHNVRVDTFQVDPARQSMRRQIAFVAQEDSLPAATTPREAIRFSARLRLSKDTTDEELETLTNRMLQELGLEAAADTIVGNALIKGISGGERKRASVGVELVTRPALVFLDEPTSGLDSFAAVKLVNLLKKVASAGSSVLFTVHQPASETFASLDQVIFMAHGQVVYQGSPEKVPEYMEDRNKSVPEHANPADWMLMVTQTMSEDELAKDNFFSVDERNLPEAEPMPKGQSMMAKTMHSESGAIVEVQKISIFVQIYELLYRDIVNTGRDTTALLTRFGASIFLGLVIGVVYQGVGATDLSDAIDLQSHFGGMTMVLIQAMFGTGISILLEFPTERPVFLREYTTDHYHIGAYIFAKFVMEAVLTFLKVMCEALILYYLMELQMPFLTYFGILYMLAMASAAIAVLFGSAMDDQKVAQESLPILYVPQFLFSGFFISITLIPPYLRWAQYLCSLTYAIRLSVVNEFDNCVGPDAQQNCNDLFEELQVDRSDVWWYWLMITVIFLIPRIGAMFALK

HMMSmart: SM00382
IPR003593
113-310 ATPases associated with a variety of cellula,NBS
AAA+ ATPase domain

AGKVTAILGPSGAGKTSLLNILAGRTISSSNLTVTHNVRVDTFQVDPARQSMRRQIAFVAQEDSLPAATTPREAIRFSARLRLSKDTTDEELETLTNRMLQELGLEAAADTIVGNALIKGISGGERKRASVGVELVTRPALVFLDEPTSGLDSFAAVKLVNLLKKVASAGSSVLFTVHQPASETFASLDQVIFMAHGQ

HMMPfam: PF00005
IPR003439
128-261 ABC_tran
ABC transporter-like

TSLLNILAGRTISSSNLTVTHNVRVDTFQVDPARQSMRRQIAFVAQEDSLPAATTPREAIRFSARLRLSKDTTDEELETLTNRMLQELGLEAAADTIVGNALIKGISGGERKRASVGVELVTRPALVFLDEPTS

Seg: seg
198-208 seg

DTTDEELETLT

PatternScan: PS00211
IPR017871
233-247 ABC_TRANSPORTER_1
ABC transporter, conserved site

ISGGERKRASVGVEL

HMMPfam: PF01061
IPR013525
401-612 ABC2_membrane
ABC-2 type transporter

QIYELLYRDIVNTGRDTTALLTRFGASIFLGLVIGVVYQGVGATDLSDAIDLQSHFGGMTMVLIQAMFGTGISILLEFPTERPVFLREYTTDHYHIGAYIFAKFVMEAVLTFLKVMCEALILYYLMELQMPFLTYFGILYMLAMASAAIAVLFGSAMDDQKVAQESLPILYVPQFLFSGFFISITLIPPYLRWAQYLCSLTYAIRLSVVNEF






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox