PRGDB00081125 (Pvr.40607)

From PRG Wiki
Jump to: navigation, search
Pvr.40607
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 304449123 (HO244846)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Saccharum hybrid cultivar

Comment?

CCTW1480.b1 CCTW Panicum virgatum Carthage normalized leaf Panicum virgatum cDNA clone CCTW1480 5', mRNA sequence

DNA Sequence

TCATGATTCTCTACAAACTCTCATATTAAGCCAAAATCAGTTTGAAGGATCTATACCAAATTCTTCTGGACGATGATATGAATGCCCTTTTTGGCGACTTTGGTATTGCAAGTTTTTACCAAAATTCTTCGTCAACATCAACTGGCGGTTTTATCACTTCATCACTCGGCGTCAAAGGGACTATAGGATATATTGCTCCAGAGTATGCGGGGGGTGCTCGCCATCCAGCAACTTCCGACGATGTTTATAGTTTTGGGATAATACTGCTTGAAATGATGACCGGAAGGAGGCCAACGGATCCTATGTTCAAGGACGGAACCAGCATTGTCAACTATGTGAAGGGGAACTTTCCACATGAAATATTGCACATCATTGATGCTCATCTAACAGAAGAATGCAAGAACTTTGCTGAAGTAAAGAAGGCATCAGAAAATGTCGTACATCAATGCTTGGTATCCGTGCTAGAAGTTGCATTTTCCTGCACGAAACCAATACCAAGCGAACGAATGGACATGAAAGAAATAGCCAGCAGAATGCATGCAATCCAAACGTCATACGTGTCAATGGGGAAGAAGAGGGTAATTATTATGCCTTCCTAGAATTGGAGTGACTCGAAACGTCGTAATCCCACAAACACATAGTATTGTGACTATAAAATAGAAAACTACCTGAAGTGGTTTAAAATTATGGTTGTATTATTGGGAACGTGATGCATATATATACGCTTCAACATGCTGTATCCGTCTGCATCAGTTTACACTGTAATAAATCTACACC


Protein sequences

Name Description Sequence
Pvr.40607 translated coding region predicted by ESTScan from UniGene Pvr.40607

XMILYKLSYXAKISLKDLYQILLDDDMNALFGDFGIASFYQNSSSTSTGGFITSSLGVKGTIGYIAPEYAGGARHPATSDDVYSFGIILLEMMTGRRPTDPMFKDGTSIVNYVKGNFPHEILHIIDAHLTEECKNFAEVKKASENVVHQCLVSVLEVAFSCTKPIPSERMDMKEIASRMHAIQTSYVSMGKKRVIIMPS

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-183 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XMILYKLSYXAKISLKDLYQILLDDDMNALFGDFGIASFYQNSSSTSTGGFITSSLGVKGTIGYIAPEYAGGARHPATSDDVYSFGIILLEMMTGRRPTDPMFKDGTSIVNYVKGNFPHEILHIIDAHLTEECKNFAEVKKASENVVHQCLVSVLEVAFSCTKPIPSERMDMKEIASRMHAIQ

superfamily: SSF56112
IPR011009
21-179 Protein kinase-like (PK-like)
Protein kinase-like domain

ILLDDDMNALFGDFGIASFYQNSSSTSTGGFITSSLGVKGTIGYIAPEYAGGARHPATSDDVYSFGIILLEMMTGRRPTDPMFKDGTSIVNYVKGNFPHEILHIIDAHLTEECKNFAEVKKASENVVHQCLVSVLEVAFSCTKPIPSERMDMKEIASRM

HMMPfam: PF00069
IPR017442
21-175 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

ILLDDDMNALFGDFGIASFYQNSSSTSTGGFITSSLGVKGTIGYIAPEYAGGARHPATSDDVYSFGIILLEMMTGRRPTDPMFKDGTSIVNYVKGNFPHEILHIIDAHLTEECKNFAEVKKASENVVHQCLVSVLEVAFSCTKPIPSERMDMKEI

Gene3D: G3DSA:1.10.510.10
21-179 no description

ILLDDDMNALFGDFGIASFYQNSSSTSTGGFITSSLGVKGTIGYIAPEYAGGARHPATSDDVYSFGIILLEMMTGRRPTDPMFKDGTSIVNYVKGNFPHEILHIIDAHLTEECKNFAEVKKASENVVHQCLVSVLEVAFSCTKPIPSERMDMKEIASRM

HMMPanther: PTHR24420
21-187 FAMILY NOT NAMED,FAMILY NOT NAMED

ILLDDDMNALFGDFGIASFYQNSSSTSTGGFITSSLGVKGTIGYIAPEYAGGARHPATSDDVYSFGIILLEMMTGRRPTDPMFKDGTSIVNYVKGNFPHEILHIIDAHLTEECKNFAEVKKASENVVHQCLVSVLEVAFSCTKPIPSERMDMKEIASRMHAIQTSYV

HMMPanther: PTHR24420:SF474
21-187 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

ILLDDDMNALFGDFGIASFYQNSSSTSTGGFITSSLGVKGTIGYIAPEYAGGARHPATSDDVYSFGIILLEMMTGRRPTDPMFKDGTSIVNYVKGNFPHEILHIIDAHLTEECKNFAEVKKASENVVHQCLVSVLEVAFSCTKPIPSERMDMKEIASRMHAIQTSYV

Seg: seg
43-57 seg

SSSTSTGGFITSSLG






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox