PRGDB00193973 (Fpr.11708)

From PRG Wiki
Jump to: navigation, search
Fpr.11708
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 237606831 (GO880230)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Festuca pratensis

Comment?

CLS_CLiFpEfSpn_81a3_1_h09cLibkit5LD_D05 CLS_CLiFpEfSPn_plant Festuca pratensis cDNA clone 81h09 5', mRNA sequence

DNA Sequence

AACGAAGAGCTGGTGAGGGCGACGGATGGGTTCTCCGATGCTAATCTCCTCGGACAAGGCGGTTTTGGATATGTTCACAAAGGGGTGCTGCCTAGCGGCAAAGAGATTGCTGTGAAGCAATTGAAACTTGGTAGTGGCCAGGGAGAGCGCGAGTTCCAGGCGGAGGTTGAGATTATCAGCAGAGTTCATCACAAGCATCTTGTGTCTCTGGTTGGTTACTGCATCTCGGGGGGAAAGAGATTGCTTGTCTACGAGTTTGTCACCAATAACACATTGGAATTCCACTTACATGGAAAAGGCCGTCCAGTGTTGGAGTGGCCCATAAGACTAAGGATTGCTCTTGGTGCTGCCAAGGGTTTAGCATATATTCACGAAGACTGCCATCCCAAGATCATACATTGTGATATAAAGTCATCAAACATTCTGCTTGACTTCAAATTTGAAGCTAAGGTTGCGGATTTTGGTCTAGCGAAATTCACTTCTGAGAACAACACTCATGTTTCGACAAGAGTAATGGGCACTTTTGGGTATCTAGCACCAGAATATGCGTCTTCTGGCAAGCTCACTGAGAAGTCAGACGTCTTCTCTTTTGGAGTGATGCTTCTTGAGCTGATAACTGGGCGTCGGCCTGTTGATTCAAACCAGACGTATATGGATGACAGCTTGGTTGACTGGGCAAGACCCCTGCTGATGCGAGCACTTGAGGATGGCAACTACGAAGAGTTAGTGGATGCTCGGCTGGGGAAGGATTTCAATCCTAATGAGATTGCCAGAATGATAGCATGTGCGGCTGCATGTGTACGCCATTCTGCACGCCGTCGCCCACGAATGAGTCAGGTTGTTCGGGCCTTGGAAGGCGACGTGTCTTTGGAGGATCTTAATGAAAGGTGTTCGTCCTGGCCATAGCCGCTTCTTTGGATCGTACAGCAGTTCTGACTACGACTCTGGTCAGTACAACGAAGACATGAAGAAGTTCAAGAGATGGCTTTTACACCAACGACTACACGAGCAGCCATACAGCGCGCGACAGCGAGTACGTCAGTAGCATCTGCATCAAGCAGCGAG


Protein sequences

Name Description Sequence
Fpr.11708 translated coding region predicted by ESTScan from UniGene Fpr.11708

NEELVRATDGFSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRALEGDVSLEDLKKGVRPGHSRFFGSYSSSDYDSGQYNEDMKKFKRWLLHQRLHEQPYSGDSEYVSSICIKQRX

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR24420
2-355 FAMILY NOT NAMED,FAMILY NOT NAMED

EELVRATDGFSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRALEGDVSLEDLKKGVRPGHSRFFGSYSSSDYDSGQYNEDMKKFKRWLLHQRLHEQPYSGDSEYVSSICIKQRX

superfamily: SSF56112
IPR011009
2-315 Protein kinase-like (PK-like)
Protein kinase-like domain

EELVRATDGFSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRALEGDVSLEDLKKGVRPGHSRFFGSYSSSDYDS

HMMPanther: PTHR24420:SF822
2-355 SUBFAMILY NOT NAMED

EELVRATDGFSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRALEGDVSLEDLKKGVRPGHSRFFGSYSSSDYDSGQYNEDMKKFKRWLLHQRLHEQPYSGDSEYVSSICIKQRX

Gene3D: G3DSA:3.30.200.20
2-72 no description

EELVRATDGFSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVG

ProfileScan: PS50011
IPR000719
11-304 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

FSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRALEGDVSLEDLKKGVRPGHSRF

HMMSmart: SM00220
IPR002290
11-340 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

FSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRALEGDVSLEDLKKGVRPGHSRFFGSYSSSDYDSGQYNEDMKKFKRWLLHQRLHEQPYS

HMMSmart: SM00219
IPR020635
11-284 Tyrosine kinase, catalytic domain
Tyrosine-protein kinase, catalytic domain

FSDANLLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRAL

HMMPfam: PF07714
IPR001245
16-284 Pkinase_Tyr
Serine-threonine/tyrosine-protein kinase catalytic

LLGQGGFGYVHKGVLPSGKEIAVKQLKLGSGQGEREFQAEVEIISRVHHKHLVSLVGYCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVVRAL

PatternScan: PS00107
IPR017441
17-39 PROTEIN_KINASE_ATP
Protein kinase, ATP binding site

LGQGGFGYVHKGVLPSGKEIAVK

Gene3D: G3DSA:1.10.510.10
73-281 no description

YCISGGKRLLVYEFVTNNTLEFHLHGKGRPVLEWPIRLRIALGAAKGLAYIHEDCHPKIIHCDIKSSNILLDFKFEAKVADFGLAKFTSENNTHVSTRVMGTFGYLAPEYASSGKLTEKSDVFSFGVMLLELITGRRPVDSNQTYMDDSLVDWARPLLMRALEDGNYEELVDARLGKDFNPNEIARMIACAAACVRHSARRRPRMSQVV

PatternScan: PS00108
IPR008271
131-143 PROTEIN_KINASE_ST
Serine/threonine-protein kinase, active site

IIHCDIKSSNILL

Seg: seg
304-316 seg

FFGSYSSSDYDSG






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox