PRGWK00000010 (MELO3C002389)

From PRG Wiki
Jump to: navigation, search


MELO3C002389
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:RLK
Location scaffold00001
Location Start 3182188
Organism Species:Cucumis melo
Approved true



CDS Sequence

ATGGCGGATTGTTATGCTCTGTTTTTACCGTTTGTTCTTGTGCTCTGTTTTTCTGTGTGGTCTGTTCAATATGGGGTTGTTTTGTGCGACGATGGGTTGAGTTTAAACGTGCTTTTGGAGATAAGGAAGTCATTTGTGGATGATCCAGAAAATGTTTTGGAGGATTGGTCTGAGAGTAATCCGAATTTTTGTAAGTGGAGAGGGGTTTCTTGTGGGTCTGACTCGGCGGGTGGCTCTGTTTCAGTGGTGGGACTTAACCTTTCTGACTCGTCACTCGGTGGGTCTATTTCACCGGCACTCGGTAGGTTACAGAACCTGCTCCACCTTGATCTTTCCAGCAACGGCTTAATGGGTCCCATTCCAACAAACCTCTCGCAACTCCATTCGCTGGAGTCTTTGTTACTTTTCTCTAACCAACTCAATGGCACGATTCCAACTGAGTTGGGCTCCATGTCGAGTTTACGAGTTATGCGAATCGGTGACAACGGACTTACTGGTCCCATTCCTTCTTCGTTTGGAAATCTTGTGAATTTGGTTACTCTTGGTTTGGCTTCGTGTAGTCTTAGCGGTTTGATACCTCCAGAACTCGGACGACTCGGCCGAGTTGAGGATATGGTTCTTCAGCAAAATCAACTTGAAGGTCCAGTTCCAAGTGAGCTTGGAAATTGTTCGAGCCTTGTTGTCTTCACTGCTGCTGGTAACAGTCTTAATGGATCGATACCGAAGCAATTGGGTCGTCTCGAGAATCTCCAAATTCTGAACCTCGCTAATAATACTCTCTCCGGTGAGATCCCGGTGGAGCTTGGGGAACTCGGTCAGCTTCTATATTTGAATCTAATGGGAAACCAACTCGAGGGTTCAATTCCAGTTTCACTTGCTGAATTGAGTAATCTTCAAAATCTTGATTTGTCTATGAACAAGCTCACAGGGGGGATTCCAGAGGAGTTGGGCAATATGGGAAGCTTGGAGTTCTTGGTTCTGTCAAACAATCCTCTTTCTGGTGTCATTCCTGGTAAGTTATGTTCTAATGCTTCAAGTTTACAACACTTGTTGCTATCTCAGATACAAATTTCCGGCGAGATTCCGGTGGAGTTGATTCAATGCAGATCTCTAACGCAGATTGATTTGTCTAACAATAGCCTAAATGGGTCGATTCCTGATGAATTTTACGAACTAAGAAGCTTGACTGACATCCTCCTTCATAACAACAGCTTAGTGGGTTCGATTTCACCGTCGATTGCAAACTTGAGCAACTTGAAAACTCTTGCTCTGTATCACAACAACCTACAGGGTGATCTCCCACGTGAGATTGGAATGCTGGGGGAGCTTGAAATTTTATATCTCTACGACAATCAGTTTTCTGGGAAAATTCCTTTCGAGTTGGGGAATTGTTCAAAGTTGCAGATGATTGATTTCTTTGGGAATCGGTTCAGTGGGGAAATTCCGGTGAGCCTTGGAAGATTGAAGGAACTGAATTTCATTCATCTCCGGCAAAACGAACTAGAGGGTAAAATTCCCGCAACTTTGGGTAACTGTCGTAAACTAACTACATTGGATTTGGCTGACAATCGTCTTTCTGGTGTAATTCCTTCAACATTTGGTTTTCTTGGAGCTCTGGAGCTGCTTATGCTTTACAACAATTCTCTTGAAGGTAATCTTCCTCGTTCTTTGATCAATTTGGCCAAACTTCAAAGAATAAATCTATCCAAAAACAGATTGAATGGGAGCATTGCTCCACTCTGTGCTTCCCCGTTTTTTCTTTCGTTCGATATTACAAACAATGCATTCGACGGTGAAATCCCTCCCCAACTGGGAAACTCATCCTCCCTTGAGAGGCTGAGATTAGGAAACAATCAATTCTCCGGTGAAATTCCGCCGGCATTGGGGAAGATTCGTGAATTATCATTGCTGGATTTATCTGGGAATTCTCTTACAGGGTCTATTCCGGCTGAGCTTTCGTTATGTAAGAAACTGACTCACCTTGATCTTAACAATAACAATCTTTCTGGAAATCTACCAATGTGGCTAGGAGGATTACCTCAATTAGGAGAGATTAAGCTTTCTTTCAATCAGTTCACTGGTCCATTACCACTGGAGTTGTTCAATTGTTCTAAACTGATTGTGCTCTCTCTTAATGAAAATTTTCTTAATGGAACACTGCCTATGGAGATTGGTAACTTGAGATCACTTAACATTCTCAACCTTGATGATAACCGGTTTTCGGGTTCAATTCCTTCAGCAATTGGTAAGATAAGCAAACTATTTGAGCTTCGTATGTCGAGAAACGGTTTAGATGGGGAAATACCAGCTGAGATTTCTCAACTACAGAATCTTCAGAGTGTATTGGACCTCAGTTACAATAATCTGACTGGTGAAATCCCATCCTCTATTGCTCTGCTATCCAAACTAGAAGCGCTTGATCTGTCTCATAATGAACTCAGTGGAGAAGTCCCTTCAGACATTAGTAAGATGAGTAGTTTGGGCAAGCTGAACCTAGCTTTCAACAAGCTAGAAGGAAAGTTGGACAAGGAATTCTCACATTGGCCAATTAGTGTATTTCAAGGAAACCTTCAACTTTGTGGAGGCCCTCTTGACCGTTGTAATGAAGTTTCTTCGAGCGAGTCGTCAAGTTTGAGTGAAGCGGCAGTGATAGCCATATCTGCAGTTTCGACCTTAGCAGGAATGGCGATTCTAGTGCTTACAGTTACCCTTCTCTATAAGCACAAACTAGAAACCTTCAAAAGATGGGGTGAAGTGAACTGTGTTTATTCTTCTAGTTCTTCCCAAGCACAGAGAAGACCACTTTTCCACAACCCTGGTGGAAATCGAGATTTCCATTGGGAAGAAATCATGGAAGTCACAAACAATTTAAGTGATGATTTCATTATCGGCTCAGGTGGCTCGGGAACAATCTATCGAGCCGAATTGCTCACCGGCGAAACTGTTGCCGTGAAGAAGATATTGTGCAAAGATGATCTTTTATCAAATAGAAGCTTCACGAGAGAGGTGAAGACACTAGGAAGGATAAAGCACAGACATCTAGTGAAACTACTTGGATATTGCATCAACAGAGGAGATGGCTCAAATCTATTGATTTACGACTACATGGAGAATGGAAGTGTTTGGGATTGGTTACACCAACAAGCAATCAATGGAAAGAAGAAAAAGAAGCTTGATTGGGAGGCAAGATTCAAGATTGCTGTTGGATTGGCTCAAGGATTGGAATATCTCCATCATGATTGTTTGCCAAAGATTGTCCATAGGGACATCAAAACAAGCAACATCCTTCTAGATTCCAATATGGAAGCACATTTGGGGGATTTTGGCCTAGCAAAAGCTCTCGTTGAGAATTATGACACAGACACCGAATCAAAAACATGGTTCGCAGGTTCTTATGGCTACATAGCTCCAGAGTACGCTTATTCTCTTAAGGCAACAGAAAAGAGTGATGTTTATAGCATGGGAATTGTACTGATGGAGCTCATAAGTGGGAAGATGCCTACTGATGAAGCCTTTGGTGTGGATATGGACATGGTAAGATGGGTAGAGACACGAATTGAAATGCAAAGTTCAACTGATAGGGAGGAGTTGATAGATCCTTGTTTGAAGCCGATTTTACCTGACGAAGAATCTGCAGCATTTCAAGTTCTTGAGATAGCTTTGCAATGTACTAAAACTGCCCCACAAGAAAGGCCAACATCTCGGCGAGTTTGTGATCAGCTACTGCATGTTTATAATCCTAGAACAGTTGGTTATGAGAAGATGAAGACAGATCCATATTCTTGAGAAGTAGGTTAATGAGTCAAGATTAGTCTGATTTCAAAGCAATGAGTTTGCTATTTTGTTATAAGAAAGAAATTTATGATATGTTTAAATACAGAGTTTCACTTGCAATGTCAAGTATCCATTAATATGAAATGAATATTCTTAGA


Protein Sequences

MADCYALFLPFVLVLCFSVWSVQYGVVLCDDGLSLNVLLEIRKSFVDDPENVLEDWSESNPNFCKWRGVSCGSDSAGGSVSVVGLNLSDSSLGGSISPALGRLQNLLHLDLSSNGLMGPIPTNLSQLHSLESLLLFSNQLNGTIPTELGSMSSLRVMRIGDNGLTGPIPSSFGNLVNLVTLGLASCSLSGLIPPELGRLGRVEDMVLQQNQLEGPVPSELGNCSSLVVFTAAGNSLNGSIPKQLGRLENLQILNLANNTLSGEIPVELGELGQLLYLNLMGNQLEGSIPVSLAELSNLQNLDLSMNKLTGGIPEELGNMGSLEFLVLSNNPLSGVIPGKLCSNASSLQHLLLSQIQISGEIPVELIQCRSLTQIDLSNNSLNGSIPDEFYELRSLTDILLHNNSLVGSISPSIANLSNLKTLALYHNNLQGDLPREIGMLGELEILYLYDNQFSGKIPFELGNCSKLQMIDFFGNRFSGEIPVSLGRLKELNFIHLRQNELEGKIPATLGNCRKLTTLDLADNRLSGVIPSTFGFLGALELLMLYNNSLEGNLPRSLINLAKLQRINLSKNRLNGSIAPLCASPFFLSFDITNNAFDGEIPPQLGNSSSLERLRLGNNQFSGEIPPALGKIRELSLLDLSGNSLTGSIPAELSLCKKLTHLDLNNNNLSGNLPMWLGGLPQLGEIKLSFNQFTGPLPLELFNCSKLIVLSLNENFLNGTLPMEIGNLRSLNILNLDDNRFSGSIPSAIGKISKLFELRMSRNGLDGEIPAEISQLQNLQSVLDLSYNNLTGEIPSSIALLSKLEALDLSHNELSGEVPSDISKMSSLGKLNLAFNKLEGKLDKEFSHWPISVFQGNLQLCGGPLDRCNEVSSSESSSLSEAAVIAISAVSTLAGMAILVLTVTLLYKHKLETFKRWGEVNCVYSSSSSQAQRRPLFHNPGGNRDFHWEEIMEVTNNLSDDFIIGSGGSGTIYRAELLTGETVAVKKILCKDDLLSNRSFTREVKTLGRIKHRHLVKLLGYCINRGDGSNLLIYDYMENGSVWDWLHQQAINGKKKKKLDWEARFKIAVGLAQGLEYLHHDCLPKIVHRDIKTSNILLDSNMEAHLGDFGLAKALVENYDTDTESKTWFAGSYGYIAPEYAYSLKATEKSDVYSMGIVLMELISGKMPTDEAFGVDMDMVRWVETRIEMQSSTDREELIDPCLKPILPDEESAAFQVLEIALQCTKTAPQERPTSRRVCDQLLHVYNPRTVGYEKMKTDPYS


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox