PRGWK00000444 (Solyc01g102880.1.1)

From PRG Wiki
Jump to: navigation, search


Solyc01g102880.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:TNL-OT
Location SL2.30ch01
Location Start 83313331
Location End 83324763
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGAGAGCTGAAAAGGCATCAGTCTCCAGGCCTAGATGCTCTTATCATGTCTACTTGAGTTATAGAGGCCAAGAAATCAGCATGAACTTTATCAATATCCTACACACTGCATTGACTGATGTAGGTATTCAAACATTCAAGAGACACAGTGAATCTAGAAATGGAAAAACTGTTGGATCAGAATTGCAAAAGGCAGTCAAGGAATCGAGGATTTCAATAGTTGTATTCACGGAAGATTATGGATATTCTAGAAGGTGCCTAGATGAACTTGTGAGCATCCTTGAAAGGAAGCAAATCGCTGGTCATATGATTCTACCTGTGTTCTATCGTGTAGATCCATCCCATGTTAGAAAGCAGAGGGGGTCGTTTGCGAAAGCATTTCATAATTACGAAGAGCAGATCATGGTGGAGAAGGTTGAAAGAAGGAATGAGCACATAGCAAAGATAAAGATATGGAGATCATCTCTTACAGATGTTGCAAATATGGCAGGCATAGTTCTAGAAGACGGGGATGAACTGAAGTTTATTCAAGAAATTGTTAAGGAAATTTGGGGTAAGTTGTCTCGCAAAGTTTTGAGTTTCGCCCCATATCCTGTTGGAATATATTCCCGTGTAAAAGAGGTTAATTTCTGGTTACAAGATAGCTCGACTAATTCTCGCACATTGATGATTTATGGAGAACCTGGAATAGGGAAAACAACAATTGCCAAAGCTCTTTTTAACCTACATTGTGACAGATTTCAATGCAGCAGTTTTCTTGGAGATATTCGAGAAATTGCAAAAGAAAGTTGTGGTTTGATTGACCTACAGAAAAACCTTCTTTCAGATCTTCTGAAAGAGGATAAGATTGATCTTAATGATATTGATAGAGGAGCTTCTACAATCAAAGACTTTTTAGTCCACAAAAAGTTTCTTCTTGTTCTTGATGATGTTGATGATTTAACCCAATTGAAAGCAATTCTTGATTCAAGAGATTGGATTCCTCCGGGGAGTAAAGTTATTATAACAACTACAAATGAACACTTGCTAAACCCTCATGATGCTTGTCTGATGTATGAAAGCAAGAGGATGGACAATCATGAGGCGCTCAAGCTCTTCAGCTTGCATACTTTTGGTCAAGACCATCCCGTCAAGGAGTACATGACACACTCCAAGCAGATAGTTAAACATTGTCAAGGGCTTCCTTTAGCTCTTCAGGTTCTAGCCTCTTCGTTACATGGTGGAAGTATAGATATGTGGGAGGGTGCAATAAAGAAATTAGAAAGATATTCTGAATCCCATAACCATAAAGTTCTTGAACTGAGCTATGAAGCTTTGCCAGATGATCATGATAAAAATGTATTTCTTGATATTGCTAGCTTCTTTGTTGGGAAAGACAAAGATTATACAATCAAAGTTCTGGATGAATGTGGTTTCCATGCTACTGCTGAAATACAGAATCTCATTGATAGATATCTTCTGACAGTGACTCCTGATAACAAGCTAATGATGCATCAGCTACTACAGGAAATGGGTAAAGAGGTCATCTGCCGAGAATCACCCATTGAACCTGGTAAACGCAGCAGAATCTGGCATCACAAGGATGCCCTTAGTATACTGCATGAAGAAACTGTTACAGAATCTATTGAAGGGCTTGTTCTTAAAATGCGTGGATCAGATGAAAGCAAACCGGACAGACATGAATGTATATCAAAAAGACCTTACTTCAATGATTCACAGAGCACTTCAACATTGACTCTCAAGAAAAAATCATCAAAGAGGCTTCGTGTAGGATGCCTCTCTTGGGGTCATGGGAATTCTGTTTCGGCAAGATCACAGACTGTACAAAATGAAGCTGGAATGAGTGCTAAAGCATTTTCTAAAATGCAAGAATTGAGATATCTTGAGCTTGAGAATGTCCAGCTTTCTGGCAGCTTTGAAGGATTTCCAAAGAAATTAAGATGGATGCGCTGGTATGGATTCCAATCAACATCCTTCCCAAATGGCTTTCCTCATGAAAATCTTGTAGTTCTTGAAATGAGCAATAGCAACTTGCATCAAACCTGGGCGGGAGCAAAGTCTGTACGATCATTGAAGATACTTGATCTTGGTCACTCACACAGTCTCATGAAGACCCCTGATTTCTCTGGATTACCGAATCTTGAAAGAGTGATTCTTGAAGATTGCATAAGTTTGGTTAAGGTCCATGAATCCATTGGAAGACTCCATAAACTTCTTGTCTTAAATCTGAAGGGATGCGAGAGCCTTAAGAAGCTTCCAAGGAAAATTTGGGAAATCAAATCCTTAGAAGAACTAACACTCTGTGGGTGCTCAAAGCTGGAGCTTTCCAGGATTATGAGAAATGGTAAGTTTTTGCAAGCACTTACACGGGATGTGACTAACAGAGATCAATTTCCCTCTAAGGCTGAAAAGCCAATATGCAGCGACTCTCTGTCGGCTAAATCAGTCAATTCAATCTTCTGGTCTTGGATGTCACTGTGGCCAAAGCCAGCAGGTTCGATGTCAGATATCTTCCAGATCACTTTACAAAGTCTGGATATTTCACATAGCAATCTGACTGACACTCTTATTCCCTGCGATCTTTCTGTCCTATCCTCCTTGAAATATCTGAGTCTAAGAGGAAATCCCATTTCCACCCTGCCAGAGAGCCTGAAGAGACTAACTATGCTGCAGTCTCTTCAGTTAGCTGACTGCACAAGGCTCCAGTGGATCCCTGAGCTTCCGCTGAGCTTACAAATATTGAATGCACGTAACTGCAGATCACTGAACAAAGTAACAAATTTACCCAATTTCATGAGGTCACTTGACTTGCACTTAGAGAATTGTGAAAAACTGGTTGAGGTTCAGGGAGTATTCAAGCTAGATCCTATTGGAGACATTGATGATATCCTCGATATGTCTTGCCTAGATAATTTGGAGGTCAGAGCAGTAGATGTGGAACTTTGCAACTATCTATCCTCAACAAAAAGCAAAGGTCCCGTTCAGGGACTGTATGAATTTGGTATAAACAACATTTACATTCCTGGAGGCAAGGTTCCTACCGAGTTCAGCAATATTAGCACAGGGAGCTCAATAGATTTCACTGTGCCTCCACTTCCTAATGCTAAGATCCAAGGATTAAATATATGTGTCGCTTATGCAGAATGTCTTGAAGAGTGTTTCAGTGAAAGGCACTTTATAAAAGTGAGCAATAAGACCAAGGGAATCAAATGGATTTATGGTCCAACAATTTTTGGAATTGCAGGTTCTGGTAAACCAATGCTATGGTTTAGTCATTGGAGATTTGGTAACCAGCTAGAAAGAGGAGATCAAGTTGTTGTTTCATTAGGCATGGGTTGCTTAGTTAAGGAATTTGGTGTAAATCTCGTATGCAACGAACAAAGTGAGGAAGAGGAAGACGCCCCATCTTTGAATGCAGAGGGACGTCTTCATCCTTCTTCCTATCCACTACAACATGCAATTGGTGGAGATTTGTCTCCTTATGAGCTAAGTTCAGCTTTGGTAGGTGCAGGGTGGCGTACGTTTAAGGATGATAATGAGATTGAGAGAGGGGAAAATATTAAGACGGAATTGGAGAATGCAATTAGAAATTCCAGGAGTTCAATAATTATCCTCTCAAAGAACTATGCTACTTCAACATGGTGCCTTGATGAACTTGTCAAAATCCTTGAACATAAGAGGACAAAAGGGCATGCAATTCTTCCTGTATTCTACCATGTGGATCCTTCTGAAGTTAGAGATCAGACAAAGAGTTTTGCAGAAGCATTTTCGACGTATGAGAGGCAAATTGAAGCTGAAAGTGATGAAGGAAAGAGGGAGTGGATGGATAAGGTCCAAAAATGGAGAGCAGCTCTTGGAGAGGTTGCAGATTTGGGTGGTGTTCTAGTCAACAATCAAGAGGATAGGAAGGAATCAGAGTTCATTGAAGAAATTCTTCAACTCATTGAGGATAAGCTGAACCGGACAATATCGAGTGTTGCACCTTACCTGGTTGGGATCAGTTCACGGCCGAGAAAAGTTCTAGATCTTCCATGGGTTTCTTTACCAAAATCTTTGGTTAATTTAAGTCTATCTGGGTGCAATCTATCTGACGTTGCTTTTCCAAGGGATTTCAGTAATTTAATGTTGTTGCAGAACCTAGACCTCAGTAAAAATCCAATCAGTTGTCTTCCAGATTGCGTCAGAACTCTGTCCAGGCTCAACAGTCTTGAATTAGGTTCTTGTACAATGCTTAAATTACTCATAGACCTACCTCGCATCCACAATTTGAGGTTGGGACACTGCACTTCCCTAGAAAGAGTAACATATCTATCAGAAGTGTGCCGTGCAGTAGTTTACCATTTAAATGGCTGTAAAGCACTCACTGATATGGAGGGAAACTTCAAGTTGGAAGCCATGGGAGGAATTGAGATAGAAAAGAAGTCATTGGAATTAAGCATGTGGGATTCTGTCGGAAGCTCCGAAGTGAAATTGTATAACAATTCAACTAATACAGAAAGTAGAGGACCAGTAAAGGTGTTGTTTGAAAGGGGGATGATCAGCATATATCTTCCGGGGAGCAAGGTTCCTAATTGGTTTTGTTACAAGAGTGCTGGAGCAACTCTATCTTTCGCTGTCCCTTCACCTCCTGATCTCAAGATCCAGGGCATAACTGTGTGCTCAGTGTACACAATTGACTGGAAAGTCTGGATTGCGGGTATCGAATTTTATTTGATAATCCATAATGAGCAGAAGAATGTGAAGCTGATTTATAGCCCGACTTGCTATGGTCTTCCTGAAGCCCAAAACGAAATGTTATGGTTCACCCATTTGATATTTCTGAGTCAGCTGGATGCTGGTGACACCTTGAATGTCTCAGTTGTTACTATGGAGGGTTTTAGCATCAAGGAAATGGGTATTCACTTGATGCATGATGAGCAAGTAGACATGATTTTGAACTCAAACAGTCATGAAATGCAGAAAGATTATCCTTATCAGGGGATGACGCCTGCCAAACGTCAAGGGCTTGTAGATTTATACTGTTTTGTTTTCGTGAATGGAAAAGTTTGCAAGGATCCAAAACTTGTGACGGCTGATGACTTCTTCAGATCAGGCCTAAACAAGCCTGGAAATACTTGGATCAATTGTTACTGCATTTCTTTAGCTCGCATTGATTTTGCACGACGTGGTCTCAATCCACCTCATACACATCCTAGAGGAACTGAGGTTCTTGTTCTTCTTAAGGGAAGACTTTATGTTGGTTTCGTCCTTTCTAACCCTGGCCCAAATATGAAGAACAAGTTATTCACCAAGATTCTGAACCCCGGTGATGTATTTGTTTTTCCTGAAGGTCTACTTCATTTTCAACTTAATGTGGGAAAGAGTAATGCCATTGCATTTGCTGGTCTGAGCAGCCAAAATCCAGGAGTTATCACAATTGCAAATGCAGTATTTGGTTCAGATCCACCAATTAACCATAATGTCCTCGCTAAAGCATTTCAAGTTGACAAGAAAGTGATTGATGATCTTCAGCAACAGTTTTGGTGGGATAATAACTAA


Protein Sequences

MRAEKASVSRPRCSYHVYLSYRGQEISMNFINILHTALTDVGIQTFKRHSESRNGKTVGSELQKAVKESRISIVVFTEDYGYSRRCLDELVSILERKQIAGHMILPVFYRVDPSHVRKQRGSFAKAFHNYEEQIMVEKVERRNEHIAKIKIWRSSLTDVANMAGIVLEDGDELKFIQEIVKEIWGKLSRKVLSFAPYPVGIYSRVKEVNFWLQDSSTNSRTLMIYGEPGIGKTTIAKALFNLHCDRFQCSSFLGDIREIAKESCGLIDLQKNLLSDLLKEDKIDLNDIDRGASTIKDFLVHKKFLLVLDDVDDLTQLKAILDSRDWIPPGSKVIITTTNEHLLNPHDACLMYESKRMDNHEALKLFSLHTFGQDHPVKEYMTHSKQIVKHCQGLPLALQVLASSLHGGSIDMWEGAIKKLERYSESHNHKVLELSYEALPDDHDKNVFLDIASFFVGKDKDYTIKVLDECGFHATAEIQNLIDRYLLTVTPDNKLMMHQLLQEMGKEVICRESPIEPGKRSRIWHHKDALSILHEETVTESIEGLVLKMRGSDESKPDRHECISKRPYFNDSQSTSTLTLKKKSSKRLRVGCLSWGHGNSVSARSQTVQNEAGMSAKAFSKMQELRYLELENVQLSGSFEGFPKKLRWMRWYGFQSTSFPNGFPHENLVVLEMSNSNLHQTWAGAKSVRSLKILDLGHSHSLMKTPDFSGLPNLERVILEDCISLVKVHESIGRLHKLLVLNLKGCESLKKLPRKIWEIKSLEELTLCGCSKLELSRIMRNGKFLQALTRDVTNRDQFPSKAEKPICSDSLSAKSVNSIFWSWMSLWPKPAGSMSDIFQITLQSLDISHSNLTDTLIPCDLSVLSSLKYLSLRGNPISTLPESLKRLTMLQSLQLADCTRLQWIPELPLSLQILNARNCRSLNKVTNLPNFMRSLDLHLENCEKLVEVQGVFKLDPIGDIDDILDMSCLDNLEVRAVDVELCNYLSSTKSKGPVQGLYEFGINNIYIPGGKVPTEFSNISTGSSIDFTVPPLPNAKIQGLNICVAYAECLEECFSERHFIKVSNKTKGIKWIYGPTIFGIAGSGKPMLWFSHWRFGNQLERGDQVVVSLGMGCLVKEFGVNLVCNEQSEEEEDAPSLNAEGRLHPSSYPLQHAIGGDLSPYELSSALVGAGWRTFKDDNEIERGENIKTELENAIRNSRSSIIILSKNYATSTWCLDELVKILEHKRTKGHAILPVFYHVDPSEVRDQTKSFAEAFSTYERQIEAESDEGKREWMDKVQKWRAALGEVADLGGVLVNNQEDRKESEFIEEILQLIEDKLNRTISSVAPYLVGISSRPRKVLDLPWVSLPKSLVNLSLSGCNLSDVAFPRDFSNLMLLQNLDLSKNPISCLPDCVRTLSRLNSLELGSCTMLKLLIDLPRIHNLRLGHCTSLERVTYLSEVCRAVVYHLNGCKALTDMEGNFKLEAMGGIEIEKKSLELSMWDSVGSSEVKLYNNSTNTESRGPVKVLFERGMISIYLPGSKVPNWFCYKSAGATLSFAVPSPPDLKIQGITVCSVYTIDWKVWIAGIEFYLIIHNEQKNVKLIYSPTCYGLPEAQNEMLWFTHLIFLSQLDAGDTLNVSVVTMEGFSIKEMGIHLMHDEQVDMILNSNSHEMQKDYPYQGMTPAKRQGLVDLYCFVFVNGKVCKDPKLVTADDFFRSGLNKPGNTWINCYCISLARIDFARRGLNPPHTHPRGTEVLVLLKGRLYVGFVLSNPGPNMKNKLFTKILNPGDVFVFPEGLLHFQLNVGKSNAIAFAGLSSQNPGVITIANAVFGSDPPINHNVLAKAFQVDKKVIDDLQQQFWWDNN


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox