PRGWK00000449 (Solyc01g104970.1.1)

From PRG Wiki
Jump to: navigation, search


Solyc01g104970.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:RLK
Location SL2.30ch01
Location Start 85051474
Location End 85059434
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGGATCAATGGGTCTTGGGGATCTTGGGGTCTGCTTCAGTTTTTCTTTGCTTAATTGGGCTGTTGCTGGTTCCTGTATATGGTAACACTGAAGGTGATGCGTTGAATGCGCTGAAGACAACCTTGGCTGATCCTAACAATGTTTTACAGAGTTGGGATCCGACCCTTGTCAATCCTTGTACTTGGTTTCATGTGACCTGCAACAGTGAGAATAGCGTAACTAGAGTTGATCTTGGAAATGCAAATTTGTCGGGTCAACTCGTTCCCCAGCTTGGTCAACTCTCGAATTTGCAATACTTGGAACTTTATAGTAATAATATAAGCGGAAGAATTCCTTATGAACTGGGGAATTTGACGAATTTGGTGAGCTTGGATCTTTACCTGAACAAGTTAGTTGGTCCAATCCCCGACACTTTGGGCAAGCTTCAGAAACTACGTTTCCTGAGGCTTAACAATAACAGTTTGACTGGACAAATTCCGGTGCTTTTAACCACAGTCACTTCACTTCAAGTGCTTGATTTGTCAAACAATAAATTAACAGGACCTGTTCCAGTCAATGGTTCCTTCTCGCTTTTTACTCCTATCAGTTTTGCGAATAATCCATTGGAAACTCCTCCAGTTTCTCCACCTCCACCTATTACTCCAACACCCACTTCTCCAGGTGTGGGAAACAGTGCAACCGGGGCGATCGCTGGCGGTGTTGCTGCAGGGGCTGCTCTTCTGTTTGCAGCTCCTGCGATTTTGCTTGCTTGGTGGCGTCGAAGGAAACCGGAAGACCACTTCTTTGATGTTCCAGCTGAGGAGGATCCAGAAGTTCATCTTGGACAACTCAAGAGGTTCTCCTTGCGCGAATTACAAGTTGCAACTGACAATTTTAGCAACAAAAATATACTCGGAAGAGGAGGATTTGGCAAGGTTTACAAGGGCAGGCTGGCTGATGGCTCTTTAGTTGCTGTTAAAAGATTAAAAGAGGAGCGTACTCAAGGCGGAGAGTTACAGTTTCAGACAGAAGTTGAAATGATTAGTATGGCCGTGCATCGAAATCTACTTCGTTTATGGGGCTTTTGCATGACAGCAACTGAACGGTTGCTTGTTTATCCATATATGGCAAATGGAAGTGTTGCTTCACGCTTGAGAGAGCGGCCAGAATCAGATCCACCACTTGGCTGGCCTATAAGGAAGTGTATAGCACTTGGATCTGCAAGAGGCCTTGCTTATTTGCATGATCATTGCGACCCTAAGATCATCCACCGTGATGTCAAAGCTGCAAATATATTGTTGGATGAGGAGTATGAAGCAGTTGTTGGGGATTTTGGGTTAGCCAAACTCATGGACTACAAGGATACTCATGTTACTACTGCTGTACGTGGTACAATTGGGCATATCGCCCCCGAGTATTTATCCACCGGTAAATCTTCAGAGAAAACTGATGTGTTTGGCTATGGAGTTATGCTTCTAGAGCTCATAACTGGGCAAAGGGCATTTGATCTTGCTCGACTTGCAAATGATGATGATGTCATGTTGCTAGATTGGGTCAAGGGACTTCTAAAGGACGAGAAGTATGAAACATTAGTAGATGCAGATCTTCAGGGTAATTATAATGAAGAAGAGGTGAAACAGCTTATTCAGGTAGCTCTACTCTGCACACAGAGCTCTCCTATGGAACGTCCAAAGATGTCGGAAGTGGTCAGAATGCTTGAAGGTGATGGCCTTGCCGAGAGGTGGGAAGAATGGCAGAAGGAAGAGATGTTCCGCCAAGACTTCAACCATGCTCACCATCCTCACACTGATTGGATTATTGCAGATTCCACTTATAATCTACGACCCGATGAGTTATCAGGGCCAAGATGA


Protein Sequences

MDQWVLGILGSASVFLCLIGLLLVPVYGNTEGDALNALKTTLADPNNVLQSWDPTLVNPCTWFHVTCNSENSVTRVDLGNANLSGQLVPQLGQLSNLQYLELYSNNISGRIPYELGNLTNLVSLDLYLNKLVGPIPDTLGKLQKLRFLRLNNNSLTGQIPVLLTTVTSLQVLDLSNNKLTGPVPVNGSFSLFTPISFANNPLETPPVSPPPPITPTPTSPGVGNSATGAIAGGVAAGAALLFAAPAILLAWWRRRKPEDHFFDVPAEEDPEVHLGQLKRFSLRELQVATDNFSNKNILGRGGFGKVYKGRLADGSLVAVKRLKEERTQGGELQFQTEVEMISMAVHRNLLRLWGFCMTATERLLVYPYMANGSVASRLRERPESDPPLGWPIRKCIALGSARGLAYLHDHCDPKIIHRDVKAANILLDEEYEAVVGDFGLAKLMDYKDTHVTTAVRGTIGHIAPEYLSTGKSSEKTDVFGYGVMLLELITGQRAFDLARLANDDDVMLLDWVKGLLKDEKYETLVDADLQGNYNEEEVKQLIQVALLCTQSSPMERPKMSEVVRMLEGDGLAERWEEWQKEEMFRQDFNHAHHPHTDWIIADSTYNLRPDELSGPR


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox