PRGWK00001234 (Sotub01g034440.1.1)

From PRG Wiki
Jump to: navigation, search


Sotub01g034440.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:RLK
Location 1
Location Start 83500081
Location End 83503851
Organism Species:Solanum tuberosum
Approved true



CDS Sequence

ATGGGAATTGCAAAAACAGTGCAGGGCTCATGTTGGCTTCTTGTATTCATGTTGTTTTTTCTGTTTAATTTATCAGATGAGTTCTTAGAACCTTCACAATCTGAAGCTATAGTGAAAATCAAGCAGCTTTTGAACTTCCCTCAAGATTTGAGTAGTTGGAGTGACAATACAGACTTTTGCAATAGTGAGCCAAACACTGCCTTGACACTCATGTGTTATGAAGATAACATAACACAGCTTCATATT


Protein Sequences

MGIAKTVQGSCWLLVFMLFFLFNLSDEFLEPSQSEAIVKIKQLLNFPQDLSSWSDNTDFCNSEPNTALTLMCYEDNITQLHISGYNWFPNLPQGFSTDTLFSNLALLPNLKVLSLVSLGLRGTLPKKIGFLSSLEIINISSNFFYGEIPGEISYLKSLQTLILDDNKFTGQVPEGVGLLHSLSVLSFKNNSFSGSLPNSLSNLQTLRILSISGNNFSGVVPNLHNLSNLQVLDLESNNLGPNFPNIP


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox