PRGWK00001306 (Sotub02g018280.1.1)

From PRG Wiki
Jump to: navigation, search


Sotub02g018280.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:RLP
Location 2
Location Start 52551135
Location End 52557164
Organism Species:Solanum tuberosum
Approved true



CDS Sequence

ATGACATATCTGGATGAGAATGAACTCTCAGGTGCCATCCCACAGCAGCTTGGGAATCTTACACAGCTACAGGAACTGGACCTACGCGCCAATTATTTCGTTGGTGAATTGCCTCCAAGCTTCATGAAGTTGGTGAACTTAGAAAAGTTTTGGGCTCAAGGGAATAGCTTGACTGGGAAATTTCCAACATTTATAGCCAATTGGACGCAACTCGATACGTTGGATCTGTTAGGAAATAATTTTGAAG


Protein Sequences

MTYLDENELSGAIPQQLGNLTQLQELDLRANYFVGELPPSFMKLVNLEKFWAQGNSLTGKFPTFIANWTQLDTLDLLGNNFEGPWPKEISSLESLVYLTLRKCSLRGPIPGYMWELKKLQNLDLSFNELSGQLPNSISTSLTSIFLRENKLNGLLPGWLTKRKNVKPHRYVDVSENLFEIKTLEFNASFDDPDV


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox