PRGWK00001851 (Sotub07g006220.1.1)

From PRG Wiki
Jump to: navigation, search


Sotub07g006220.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:N
Location 7
Location Start 1350932
Location End 1353215
Organism Species:Solanum tuberosum
Approved true



CDS Sequence

ATGAAGAAGAAATCAAAAGAGGATGAGAATGATATCTCGAGAAAGCCTTGTTATCTACTTTTCCTCGTTGTGCTAGTGGAGCTGGAAATGCAAAAGATTATTCTTGGTGAACTAAAGGCTTCAAAGTTTGCTCAATCAAGAATTTTCAAGGATAAGATATTACCAAAAGGATTTTCATATCATCTACGTAATCTGCTGGTGTATCTTAGAAATGAAAAGCTTAAGAAACTTCCTACTAATGTCACT


Protein Sequences

MKKKSKEDENDISRKPCYLLFLVVLVELEMQKIILGELKASKFAQSRIFKDKILPKGFSYHLRNLLVYLRNEKLKKLPTNVTARNIDVAIEFLLVFLGDVPNHVINGKGLNEVLANIGVLVGDVLCVIQMLLAESTIKEDSSKIDLDTMQILVKIEDLRAQVEERDVAKVQHKHDEIPKDLQRCALNLAYEAEVSIDSILVKYNALWHSFCSLPAIIEEINHINVEVTKMGSVNLALRPFFVVEPSK


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox