PRGWK00002021 (Sotub09g018030.1.1)

From PRG Wiki
Jump to: navigation, search


Sotub09g018030.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:CNL
Location 9
Location Start 34890328
Location End 34893839
Organism Species:Solanum tuberosum
Approved true



CDS Sequence

ATGGAGGTTGGCTTAGCAGTTGGTGGTGCATTTCTCTCTTCAGCTTTGAATGTTTTCTTTGATAGGCTTTCTCCTCATGGTGATCTGCTTAACATGTTTCGGAAGCATAAGGATCATGTTCAGCTCTTACACAAACTGGAGGACATTTTGCTTGGTCTTCAGATTGTGCTAAGTGATGCAGAGAATAAGCAAGCATCAAATCGACACGTGAGCCAGTGGTTTAATAAGCTTCAGAGTGCTGTGGAC


Protein Sequences

MEVGLAVGGAFLSSALNVFFDRLSPHGDLLNMFRKHKDHVQLLHKLEDILLGLQIVLSDAENKQASNRHVSQWFNKLQSAVDGAENLIEQVNYEALRVKVEGHHKKMGGLGKTTLAKAVYNDEKVKDHFGLQAWFCVSEAYDAFRITKGLLQEIGSFDLKADDNLNQLKVKLKESLKGKKFLIVLDDVWNENYNEWDDLRNVFVQGDIGSKIIVTTRKASVALMMGSEAINIGKQIADKCKGLPLA


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox