PRGWK00002482 (Rx 1)

From PRG Wiki
Jump to: navigation, search


Rx 1
Author User:Felice
Synonyms RGC1
Gene Type Contributed R-Genes
GenBank ID AAF76163.1
GenBank Locus AF266747_1
Gene Class Class:CNL
Chromosome 12
Location PGSC0003DMT400020353
Location Start 1744638
Location End 1747781
Organism Species:Solanum tuberosum
Donor Organism Species:Solanum tuberosum
Approved Yes

List of References

E A van der Vossen, J N van der Voort, K Kanyuka, A Bendahmane, H Sandbrink, D C Baulcombe, J Bakker, W J Stiekema, R M Klein-Lankhorst
Homologues of a single resistance-gene cluster in potato confer resistance to distinct pathogens: a virus and a nematode.
Plant J.: 2000, 23(5);567-76
PubMed:10972883 WorldCat.org (P p)



CDS Sequence

ATGGCTTATGCTGCTGTTACTTCCCTTATGAGAACCATACATCAATCAATGGAACTTACTGGATGTGATTTGCAACCGTTTTATGAAAAGCTCAAATCTTTGAGAGCTATTCTGGAGAAATCCTGCAATATAATGGGCGATCATGAGGGGTTAACAATCTTAAAAGTTGAAATCGTAGAGGTAGCATACACAACAGAAGATATGGTTGACTCGGAATCAAGAAATGTTTTTTTAGCACAAAATTTGGAGGAAAGAAGCAGGGCTATGTGGGAGATTTTTTTCGTCTTGGAACAAGCACTAGAATGCATTGATTCCACCGTGAAACAGTGGATGGCAGCATCGGACAGCATGAAAGATCTAAAACCACAAACTAGCTCACTTGTCAGTTTACCTGAACATGATGTTGAGCAGCCCGATAATATAATGGTTGGCCGTGAAAATGAATTTGAGATGATGCTGGATCAACTTGCTAGAGGAGGAAGGGAACTAGAAGTTGTCTCAATCGTAGGGATGGGAGGCATCGGGAAAACAACTTTGGCTGCAAAACTCTATAGTGATCCTTACATTATGTCTCGATTTGATATTCGTGCAAAAGCAACTGTTTCACAAGAGTATTGTGTGAGAAATGTATTCCTAGGCCTTCTTTCTTTGACAAGTGATGAACCTGATGATCAGCTAGCGGACAGACTGCAAAAGCATTTGAAAGGCAGGAGATACTTGGTAGTCATTGATGACATATGGACTACAGAAGCTTGGGATGATATAAAACTATGTTTCCCAGACTGTTATAATGGAAGCAGAATACTCCTGACTACTCGGAATGTGGAAGTGGCTGAAAATGCTAGCTCAGGTAAGCCTCCTCATCACATGCGCATCATGAATTTTGACGAAAGTTGGAATTTACTACACAAAAAGATCTTTGAAACAGAAGGTTCTTATTCTCCTGAATTTGAAAATATTGGGAAACAAATTGCATTAAAATGTGGAGGATTACCTCTAGCAATTACTGTGATTGCTGGACTTCTCTCCAAAATGGGTCAAAGATTAGATAAGTGGCAAAGAATTGCGGAGAATGTAAGTTCGGTGGTAAGCACAGATCCTGAAGCACAATGCATGAGAGTGTTGGCTTTGAGTTACCATCACTTGCCTTCTCACCTAAAACCGTGTTTTCTATATTTTGCAATTTTCGCAGAGGATGAAGAGATTTATGTAAATAAACTTGTTGACTTATGGGCTGTAGAGGGGTTTTTGAATGAAGAAGAGGGAAAAAGCATAGAAGAGGTGCCAGAAACATGTATAAACGAGCTTGTAGATAGAAGTCTAATTTCTATCCACAATTTGAGTTTTGATGGGAAAATAGAGAGATGTGAAATGCATGATGTGACCCGTGAACTCTGTTTGAGGGAAGCTCGAAACATGAATTTTGTGAATGTTATCAGAGGAAATAGTGATCAAAATTCATGTGCACAATCCATGCAGTGTTCCTTTAAGAGTCGAAGTCGGATCAGTATCCATAATGATGAAGAATTGGTTTGGTGTCGTAACAGTGAGGCTCATTCTATCATCACGTTCTGTGGTTTCAAATTCGTCACACTGGAATTGTCTTTCAAGCTAGTAAGAGTACTAGATCTTGGTTCGACTATATGCCCAATTTTTCCCAGTGGAGTACTTTCTCTAATTCATTTGAGATACCTATCTCTGTGTTTTAATCCTTGCTTAAAGCAGTATCGAGGATCGTTAGAAGCTGTTCCCTCATCAATAATAGACATTCCTCTATCGATATCAAGCCTATGCTATCTGCAAACTTTTAAACTTTGCTTTCCGTTTCCCTATCGTGATGATGTTTATCCTTTCATATTACCATCGGAAATTTTAACGATGCCACAATTGAGGAAGCTGTGTATGGGCTGGAATTACTTGCGGAGTCATGAGCCTACAGAGAACAGATTGGTTTTGAAAAGTTTGCAATGCCTCCATCAATTGAATCCTTGGTATTGTACAGGGTCTTTTTTTAGACTAATTCCCAATTTAAAGAAGTTGAAAGTATTTGGCATCCAACAGGACTTCCGCAATCGCAAGGACCCGTATGATTTTCGCTACTTATATCAGCTCGAGAAATTGGAATTTAGTATTTGGCGTCCCGCAGGACAAGTTGCTGCTTGCATTCTAAAAAACACTGCACCTTCAGGTTCTACTCCGCAAGAACCTCTGAGGTTTCAGACGGAAATATTTCACAGATACACATTTTTCTGGGAAACTGCTCCAACTTTACTCTTACCTCCTCCGGATGCTTTTCCACAAAACCTTAAGAGTTTAACTTTTAGGGGAGAATTCTTTTTGGCATGGAAGGATTTGAGCATTGTTGGTAAATTACCCAAACTCGAGGTCCTTAAACTATCATACAATCCCTTCAAAGGCGAGGAGTGGGAAGTAGTTGCGGAAGGGTTTCCTCACTTGAAGTTCTTGTTTCTGGATAAAGTATACATTCGGTACTGGAGAGCTAGTAGTGATCACTTTCCGTACCTTGAACGACTTTTTCTTAGAGCTTGCTATTTTTTGGATTCAATCCCTCGAGATTTTGCAGATATAACCACACTAGCTCTTATTGATATAACTCGCTGCCAACAATCTGTTGGGAATTCCGCCAAGCAAATTCAACAGGACATTCAAGACAACTATGGAAGCTCTATCGAGGTCCATACTCGTAATCTTCTCGTTTTCGATAGTGTGACAACAGATGAAGATGATGATGATGATGACTTTGAGAAAGAAGTTGCTTCTTGCCACAATAATCGAGTAG


Protein Sequences

  • Name: RGC1

MAYAAVTSLMRTIHQSMELTGCDLQPFYEKLKSLRAILEKSCNIMGDHEGLTILKVEIVEVAYTTEDMVDSESRNVFLAQNLEERSRAMWEIFFVLEQALECIDSTVKQWMAASDSMKDLKPQTSSLVSLPEHDVEQPDNIMVGRENEFEMMLDQLARGGRELEVVSIVGMGGIGKTTLAAKLYSDPYIMSRFDIRAKATVSQEYCVRNVFLGLLSLTSDEPDDQLADRLQKHLKGRRYLVVIDDIWTTEAWDDIKLCFPDCYNGSRILLTTRNVEVAENASSGKPPHHMRIMNFDESWNLLHKKIFETEGSYSPEFENIGKQIALKCGGLPLAITVIAGLLSKMGQRLDKWQRIAENVSSVVSTDPEAQCMRVLALSYHHLPSHLKPCFLYFAIFAEDEEIYVNKLVDLWAVEGFLNEEEGKSIEEVPETCINELVDRSLISIHNLSFDGKIERCEMHDVTRELCLREARNMNFVNVIRGNSDQNSCAQSMQCSFKSRSRISIHNDEELVWCRNSEAHSIITFCGFKFVTLELSFKLVRVLDLGSTICPIFPSGVLSLIHLRYLSLCFNPCLKQYRGSLEAVPSSIIDIPLSISSLCYLQTFKLCFPFPYRDDVYPFILPSEILTMPQLRKLCMGWNYLRSHEPTENRLVLKSLQCLHQLNPWYCTGSFFRLIPNLKKLKVFGIQQDFRNRKDPYDFRYLYQLEKLEFSIWRPAGQVAACILKNTAPSGSTPQEPLRFQTEIFHRYTFFWETAPTLLLPPPDAFPQNLKSLTFRGEFFLAWKDLSIVGKLPKLEVLKLSYNPFKGEEWEVVAEGFPHLKFLFLDKVYIRYWRASSDHFPYLERLFLRACYFLDSIPRDFADITTLALIDITRCQQSVGNSAKQIQQDIQDNYGSSIEVHTRNLLVFDSVTTDEDDDDDDFEKEVASCHNNRV





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox