PRGWK00002483 (Mi-1)

From PRG Wiki
Jump to: navigation, search


Mi-1
Author User:Felice
Gene Type Contributed R-Genes
GenBank ID AAC97933.1
GenBank Locus AAC97933
Gene Class Class:CNL
Chromosome 6
Location Start 2722296
Location End 2750582
Organism Species:Solanum lycopersicum
Donor Organism Species:Solanum lycopersicum
Description Lycopersicon esculentum disease resistance protein (Mi-1) gene
Approved Yes

List of References

CDS Sequence

ATGGAAAAACGAAAAGATATTGAAGAAGCAAACAACTCATTGGTGTTATTTTCTGCTCTTAGCAAGGACATTGCCAATGTTCTAATTTTCCTAGAGAATGAGGAAAATCAAAAAGCTCTTGACAAAGATCAAGTTGAAAAGCTAAAATTGAAAATGGCATTTATTTGTACATATGTTCAGCTTTCTTATTCCGATTTTGAGCAGTTTGAAGATATAATGACTAGAAATAGACAAGAGGTTGAGAATCTGCTTCAATCACTTTTGGATGATGATGTCCTTACTAGCCTCACCAGTAATATGGATGACTGTATCAGCTTGTATCATCGTTCTTATAAATCAGATGCCATCATGATGGATGAGCAATTGGACTTCCTCCTCTTGAATCTGTATCATCTATCCAAGCATCACGCTGAAAAGATATTTCCTGGAGTGACTCAATATGAAGTTCTTCAGAATGTATGTGGCAACATAAGAGATTTCCATGGGTTGATACTGAATGGTTGCATTAAGCATGAGATGGTTGAGAATGTCTTACCTCTGTTTCAACTCATGGCTGAAAGAGTAGGACACTTCCTTTGGGAGGATCAGACTGATGAAGACTCTCGGCTCTCCGAGCTAGATGAGGATGAACACAATGATAGAGACTCTCGACTCTTCCAGCTAACACATCTACTCTTGAAGATTGTTCCAACTGAACTGGAGGTTATGCACATATGTTATACAAATTTGAAAGCTTCAACTTCAGCAGAAGTTGGACGCTTCATTAAGAAGCTCCTGGAAACCTCACCGGATATTCTCAGAGAATATATCATTCAACTACAAGAGCATATGTTAACTGTTATTCCCCCTAGCACTTTAGGGGCTCGAAACATTCATGTCATGATGGAATTCCTATTACTTATTCTTTCTGATATGCCCAAGGACTTTATTCATCATGACAAACTTTTTGATCTCTTGGCTCATGTTGGAACACTTACCAGGGAGGTATCGACTCTTGTACGTGACTTGGAAGAGAAATTAAGGAATAAAGAGGGTAATAACCAAACAAATTGTGCAACCCTAGACTTGCTGGAAAATATTGAACTCCTCAAGAAAGATCTCAAACATGTTTATCTGAAAGCCCCAAATTCATCTCAATGTTGCTTCCCCATGAGTGATGGACCACTCTTCATGCATCTTCTACACATGCACTTAAATGATTTGCTAGATTCTAATGCTTATTCAATTTCTTTGATAAAGGAAGAAATCGAGTTGGTGAGTCAAGAACTGGAATTCATAAGATCATTCTTTGGGGATGCTGCTGAGCAAGGATTGTATAAAGATATCTGGGCACGTGTTCTAGATGTGGCTTATGAGGCAAAAGATGTCATAGATTCAATTATTGTTCGAGATAATGGTCTCTTACATCTTATTTTCTCACTTCCCATTACCATAAAGAAGATCAAACTTATCAAAGAAGAGATCTCTGCTTTAGATGAGAACATTCCCAAGGACAGAGGTCTAATCGTTGTGAACTCTCCCAAGAAACCAGTTGAGAGAAAGTCATTGACAACTGATAAAATAATTGTAGGTTTTGAGGAGGAGACAAACTTGATACTTAGAAAGCTCACCAGTGGACCCGCAGATTTAGATGTCATTTCGATCACCGGTATGCCGGGTTCAGGTAAAACTACTTTGGCATACAAAGTATACAATGATAAGTCAGTTTCTAGACATTTTGACCTTCGTGCATGGTGCACGGTCGATCAAGGATATGACGACAAGAAGTTGTTGGATACAATTTTCAGTCAAGTTAGTGGCTCAGATTCAAATTTGAGTGAGAATATTGATGTTGCTGATAAATTGCGGAAACAACTGTTTGGAAAGAGGTATCTTATTGTCTTAGATGATGTGTGGGATACTACTACATTGGATGAGTTGACAAGACCTTTTCCTGAAGCTAAGAAAGGAAGTAGGATTATTTTGACAACTCGAGAAAAGGAAGTGGCTTTGCATGGAAAGCTGAACACTGATCCTCTTGACCTTCGATTGCTAAGACCAGATGAAAGTTGGGAACTTTTAGAGAAAAGGACATTTGGTAATGAGAGTTGCCCTGATGAACTATTAGATGTCGGTAAAGAAATAGCCGAAAATTGTAAAGGGCTTCCTTTGGTGGCTGATCTGATTGCTGGAGTCATTGCTGGGAGGGAAAAGAAAAGGAGTGTGTGGCTTGAAGTTCAAAGTAGTTTGAGTTCTTTTATTTTGAACAGTGAAGTGGAAGTGATGAAAGTTATAGAATTAAGTTATGACCATTTACCACATCACCTCAAGCCATGCTTGCTTCACTTTGCAAGTTGGCCGAAGGACACTCCTTTGACAATCTATTTGTTGACTGTTTATTTGGGTGCTGAAGGATTTGTGGAAAAGACGGAGATGAAGGGTATAGAAGAAGTGGTGAAGATTTATATGGATGATTTAATTTCCAGTAGCTTGGTAATTTGTTTCAATGAGATAGGTGATATACTGAATTTCCAAATTCATGATCTTGTGCATGACTTTTGTTTGATAAAAGCAAGAAAGGAAAATTTGTTTGATCGGATAAGATCAAGTGCTCCATCAGATTTGTTGCCTCGTCAAATTACCATTGATTATGATGAGGAGGAGGAGCACTTTGGGCTTAATTTTGTCATGTTCGATTCAAATAAGAAAAGGCATTCTGGTAAACACCTCTATTCTTTGAGGATAAATGGAGACCAGCTGGATGACAGTGTTTCTGATGCATTTCACCTAAGACACTTGAGGCTTATTAGAGTGTTGGACCTGGAACCCTCTTTAATCATGGTGAATGATTCTTTGCTGAATGAAATATGCATGTTGAATCATTTGAGGTACTTAAGAATTCGGACACAAGTTAAATATCTGCCTTTCTCTTTCTCAAACCTCTGGAATCTAGAAAGTCTGTTTGTGTCTAACAAAGGATCAATCTTGGTACTATTACCGAGAATTTTGGATCTTGTAAAGTTGCGAGTGCTGTCCGTGGGTGCTTGTTCTTTCTTTGATATGGATGCAGATGAATCAATATTGATAGCAAAGGACACAAAGTTAGAGAACTTGAGAATATTAGGGGAACTGTTGATTTCCTATTCGAAAGATACAATGAATATTTTCAAAAGGTTTCCCAATCTTCAGGTGCTTCAGTTTGAACTCAAGGAGTCATGGGATTATTCAACAGAGCAACATTGGTTCCCGAAATTGGATTGCCTAACTGAACTAGAAACACTCTGTGTAGGTTTTAAAAGTTCAAACACAAACCACTGTGGGTCCTCTGTTGCGACAAATCGGCCGTGGGATTTTCACTTCCCTTCAAATTTGAAAGAACTGTTGTTGTATGACTTTCCTCTGACATCCGATTCACTATCAACAATAGCGAGACTGCCCAACCTTGAAAATTTGTCCCTTTATGATACAATCATCCAGGGAGAAGAATGGAACATGGGGGAGGAAGACACTTTTGAGAATCTCAAATTTTTGAACTTGCGTCTACTGACTCTTTCCAAGTGGGAGGTTGGAGAGGAATCCTTCCCCAATCTTGAGAAATTAAAACTGCAGGAATGTGGTAAGCTTGAGGAGATTCCACCTAGTTTTGGAGATATTTATTCATTGAAATTTATCAAAATTGTAAAGAGTCCTCAACTTGAAGATTCTGCTCTCAAGATTAAGAAATACGCTGAAGATATGAGAGGAGGGAACGAGCTTCAGATCCTTGGCCAGAAGAATATCCCCTTATTTAAGTAG


Protein Sequences

  • Name: Mi-1

MEKRKDIEEANNSLVLFSALSKDIANVLIFLENEENQKALDKDQVEKLKLKMAFICTYVQLSYSDFEQFEDIMTRNRQEVENLLQSLLDDDVLTSLTSNMDDCISLYHRSYKSDAIMMDEQLDFLLLNLYHLSKHHAEKIFPGVTQYEVLQNVCGNIRDFHGLILNGCIKHEMVENVLPLFQLMAERVGHFLWEDQTDEDSRLSELDEDEHNDRDSRLFQLTHLLLKIVPTELEVMHICYTNLKASTSAEVGRFIKKLLETSPDILREYIIQLQEHMLTVIPPSTLGARNIHVMMEFLLLILSDMPKDFIHHDKLFDLLAHVGTLTREVSTLVRDLEEKLRNKEGNNQTNCATLDLLENIELLKKDLKHVYLKAPNSSQCCFPMSDGPLFMHLLHMHLNDLLDSNAYSISLIKEEIELVSQELEFIRSFFGDAAEQGLYKDIWARVLDVAYEAKDVIDSIIVRDNGLLHLIFSLPITIKKIKLIKEEISALDENIPKDRGLIVVNSPKKPVERKSLTTDKIIVGFEEETNLILRKLTSGPADLDVISITGMPGSGKTTLAYKVYNDKSVSRHFDLRAWCTVDQGYDDKKLLDTIFSQVSGSDSNLSENIDVADKLRKQLFGKRYLIVLDDVWDTTTLDELTRPFPEAKKGSRIILTTREKEVALHGKLNTDPLDLRLLRPDESWELLEKRTFGNESCPDELLDVGKEIAENCKGLPLVADLIAGVIAGREKKRSVWLEVQSSLSSFILNSEVEVMKVIELSYDHLPHHLKPCLLHFASWPKDTPLTIYLLTVYLGAEGFVEKTEMKGIEEVVKIYMDDLISSSLVICFNEIGDILNFQIHDLVHDFCLIKARKENLFDRIRSSAPSDLLPRQITIDYDEEEEHFGLNFVMFDSNKKRHSGKHLYSLRINGDQLDDSVSDAFHLRHLRLIRVLDLEPSLIMVNDSLLNEICMLNHLRYLRIRTQVKYLPFSFSNLWNLESLFVSNKGSILVLLPRILDLVKLRVLSVGACSFFDMDADESILIAKDTKLENLRILGELLISYSKDTMNIFKRFPNLQVLQFELKESWDYSTEQHWFPKLDCLTELETLCVGFKSSNTNHCGSSVATNRPWDFHFPSNLKELLLYDFPLTSDSLSTIARLPNLENLSLYDTIIQGEEWNMGEEDTFENLKFLNLRLLTLSKWEVGEESFPNLEKLKLQECGKLEEIPPSFGDIYSLKFIKIVKSPQLEDSALKIKKYAEDMRGGNELQILGQKNIPLFK





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox