PRGWK00002483 (Mi-1)

From PRG Wiki
Jump to: navigation, search


Mi-1
Author User:Felice
Gene Type Contributed R-Genes
GenBank ID AAC97933.1
GenBank Locus AAC97933
Gene Class Class:CNL
Chromosome 6
Location Start 2722296
Location End 2750582
Organism Species:Solanum lycopersicum
Donor Organism Species:Solanum lycopersicum
Description Lycopersicon esculentum disease resistance protein (Mi-1) gene
Approved Yes

List of References

P Vos, G Simons, T Jesse, J Wijbrandi, L Heinen, R Hogers, A Frijters, J Groenendijk, P Diergaarde, M Reijans, J Fierens-Onstenk, M de Both, J Peleman, T Liharska, J Hontelez, M Zabeau
The tomato Mi-1 gene confers resistance to both root-knot nematodes and potato aphids.
Nat. Biotechnol.: 1998, 16(13);1365-9
PubMed:9853621 WorldCat.org DOI (P p)



CDS Sequence

ATGGAAAAACGAAAAGATATTGAAGAAGCAAACAACTCATTGGTGTTATTTTCTGCTCTTAGCAAGGACATTGCCAATGTTCTAATTTTCCTAGAGAATGAGGAAAATCAAAAAGCTCTTGACAAAGATCAAGTTGAAAAGCTAAAATTGAAAATGGCATTTATTTGTACATATGTTCAGCTTTCTTATTCCGATTTTGAGCAGTTTGAAGATATAATGACTAGAAATAGACAAGAGGTTGAGAATCTGCTTCAATCACTTTTGGATGATGATGTCCTTACTAGCCTCACCAGTAATATGGATGACTGTATCAGCTTGTATCATCGTTCTTATAAATCAGATGCCATCATGATGGATGAGCAATTGGACTTCCTCCTCTTGAATCTGTATCATCTATCCAAGCATCACGCTGAAAAGATATTTCCTGGAGTGACTCAATATGAAGTTCTTCAGAATGTATGTGGCAACATAAGAGATTTCCATGGGTTGATACTGAATGGTTGCATTAAGCATGAGATGGTTGAGAATGTCTTACCTCTGTTTCAACTCATGGCTGAAAGAGTAGGACACTTCCTTTGGGAGGATCAGACTGATGAAGACTCTCGGCTCTCCGAGCTAGATGAGGATGAACACAATGATAGAGACTCTCGACTCTTCCAGCTAACACATCTACTCTTGAAGATTGTTCCAACTGAACTGGAGGTTATGCACATATGTTATACAAATTTGAAAGCTTCAACTTCAGCAGAAGTTGGACGCTTCATTAAGAAGCTCCTGGAAACCTCACCGGATATTCTCAGAGAATATATCATTCAACTACAAGAGCATATGTTAACTGTTATTCCCCCTAGCACTTTAGGGGCTCGAAACATTCATGTCATGATGGAATTCCTATTACTTATTCTTTCTGATATGCCCAAGGACTTTATTCATCATGACAAACTTTTTGATCTCTTGGCTCATGTTGGAACACTTACCAGGGAGGTATCGACTCTTGTACGTGACTTGGAAGAGAAATTAAGGAATAAAGAGGGTAATAACCAAACAAATTGTGCAACCCTAGACTTGCTGGAAAATATTGAACTCCTCAAGAAAGATCTCAAACATGTTTATCTGAAAGCCCCAAATTCATCTCAATGTTGCTTCCCCATGAGTGATGGACCACTCTTCATGCATCTTCTACACATGCACTTAAATGATTTGCTAGATTCTAATGCTTATTCAATTTCTTTGATAAAGGAAGAAATCGAGTTGGTGAGTCAAGAACTGGAATTCATAAGATCATTCTTTGGGGATGCTGCTGAGCAAGGATTGTATAAAGATATCTGGGCACGTGTTCTAGATGTGGCTTATGAGGCAAAAGATGTCATAGATTCAATTATTGTTCGAGATAATGGTCTCTTACATCTTATTTTCTCACTTCCCATTACCATAAAGAAGATCAAACTTATCAAAGAAGAGATCTCTGCTTTAGATGAGAACATTCCCAAGGACAGAGGTCTAATCGTTGTGAACTCTCCCAAGAAACCAGTTGAGAGAAAGTCATTGACAACTGATAAAATAATTGTAGGTTTTGAGGAGGAGACAAACTTGATACTTAGAAAGCTCACCAGTGGACCCGCAGATTTAGATGTCATTTCGATCACCGGTATGCCGGGTTCAGGTAAAACTACTTTGGCATACAAAGTATACAATGATAAGTCAGTTTCTAGACATTTTGACCTTCGTGCATGGTGCACGGTCGATCAAGGATATGACGACAAGAAGTTGTTGGATACAATTTTCAGTCAAGTTAGTGGCTCAGATTCAAATTTGAGTGAGAATATTGATGTTGCTGATAAATTGCGGAAACAACTGTTTGGAAAGAGGTATCTTATTGTCTTAGATGATGTGTGGGATACTACTACATTGGATGAGTTGACAAGACCTTTTCCTGAAGCTAAGAAAGGAAGTAGGATTATTTTGACAACTCGAGAAAAGGAAGTGGCTTTGCATGGAAAGCTGAACACTGATCCTCTTGACCTTCGATTGCTAAGACCAGATGAAAGTTGGGAACTTTTAGAGAAAAGGACATTTGGTAATGAGAGTTGCCCTGATGAACTATTAGATGTCGGTAAAGAAATAGCCGAAAATTGTAAAGGGCTTCCTTTGGTGGCTGATCTGATTGCTGGAGTCATTGCTGGGAGGGAAAAGAAAAGGAGTGTGTGGCTTGAAGTTCAAAGTAGTTTGAGTTCTTTTATTTTGAACAGTGAAGTGGAAGTGATGAAAGTTATAGAATTAAGTTATGACCATTTACCACATCACCTCAAGCCATGCTTGCTTCACTTTGCAAGTTGGCCGAAGGACACTCCTTTGACAATCTATTTGTTGACTGTTTATTTGGGTGCTGAAGGATTTGTGGAAAAGACGGAGATGAAGGGTATAGAAGAAGTGGTGAAGATTTATATGGATGATTTAATTTCCAGTAGCTTGGTAATTTGTTTCAATGAGATAGGTGATATACTGAATTTCCAAATTCATGATCTTGTGCATGACTTTTGTTTGATAAAAGCAAGAAAGGAAAATTTGTTTGATCGGATAAGATCAAGTGCTCCATCAGATTTGTTGCCTCGTCAAATTACCATTGATTATGATGAGGAGGAGGAGCACTTTGGGCTTAATTTTGTCATGTTCGATTCAAATAAGAAAAGGCATTCTGGTAAACACCTCTATTCTTTGAGGATAAATGGAGACCAGCTGGATGACAGTGTTTCTGATGCATTTCACCTAAGACACTTGAGGCTTATTAGAGTGTTGGACCTGGAACCCTCTTTAATCATGGTGAATGATTCTTTGCTGAATGAAATATGCATGTTGAATCATTTGAGGTACTTAAGAATTCGGACACAAGTTAAATATCTGCCTTTCTCTTTCTCAAACCTCTGGAATCTAGAAAGTCTGTTTGTGTCTAACAAAGGATCAATCTTGGTACTATTACCGAGAATTTTGGATCTTGTAAAGTTGCGAGTGCTGTCCGTGGGTGCTTGTTCTTTCTTTGATATGGATGCAGATGAATCAATATTGATAGCAAAGGACACAAAGTTAGAGAACTTGAGAATATTAGGGGAACTGTTGATTTCCTATTCGAAAGATACAATGAATATTTTCAAAAGGTTTCCCAATCTTCAGGTGCTTCAGTTTGAACTCAAGGAGTCATGGGATTATTCAACAGAGCAACATTGGTTCCCGAAATTGGATTGCCTAACTGAACTAGAAACACTCTGTGTAGGTTTTAAAAGTTCAAACACAAACCACTGTGGGTCCTCTGTTGCGACAAATCGGCCGTGGGATTTTCACTTCCCTTCAAATTTGAAAGAACTGTTGTTGTATGACTTTCCTCTGACATCCGATTCACTATCAACAATAGCGAGACTGCCCAACCTTGAAAATTTGTCCCTTTATGATACAATCATCCAGGGAGAAGAATGGAACATGGGGGAGGAAGACACTTTTGAGAATCTCAAATTTTTGAACTTGCGTCTACTGACTCTTTCCAAGTGGGAGGTTGGAGAGGAATCCTTCCCCAATCTTGAGAAATTAAAACTGCAGGAATGTGGTAAGCTTGAGGAGATTCCACCTAGTTTTGGAGATATTTATTCATTGAAATTTATCAAAATTGTAAAGAGTCCTCAACTTGAAGATTCTGCTCTCAAGATTAAGAAATACGCTGAAGATATGAGAGGAGGGAACGAGCTTCAGATCCTTGGCCAGAAGAATATCCCCTTATTTAAGTAG


Protein Sequences

  • Name: Mi-1

MEKRKDIEEANNSLVLFSALSKDIANVLIFLENEENQKALDKDQVEKLKLKMAFICTYVQLSYSDFEQFEDIMTRNRQEVENLLQSLLDDDVLTSLTSNMDDCISLYHRSYKSDAIMMDEQLDFLLLNLYHLSKHHAEKIFPGVTQYEVLQNVCGNIRDFHGLILNGCIKHEMVENVLPLFQLMAERVGHFLWEDQTDEDSRLSELDEDEHNDRDSRLFQLTHLLLKIVPTELEVMHICYTNLKASTSAEVGRFIKKLLETSPDILREYIIQLQEHMLTVIPPSTLGARNIHVMMEFLLLILSDMPKDFIHHDKLFDLLAHVGTLTREVSTLVRDLEEKLRNKEGNNQTNCATLDLLENIELLKKDLKHVYLKAPNSSQCCFPMSDGPLFMHLLHMHLNDLLDSNAYSISLIKEEIELVSQELEFIRSFFGDAAEQGLYKDIWARVLDVAYEAKDVIDSIIVRDNGLLHLIFSLPITIKKIKLIKEEISALDENIPKDRGLIVVNSPKKPVERKSLTTDKIIVGFEEETNLILRKLTSGPADLDVISITGMPGSGKTTLAYKVYNDKSVSRHFDLRAWCTVDQGYDDKKLLDTIFSQVSGSDSNLSENIDVADKLRKQLFGKRYLIVLDDVWDTTTLDELTRPFPEAKKGSRIILTTREKEVALHGKLNTDPLDLRLLRPDESWELLEKRTFGNESCPDELLDVGKEIAENCKGLPLVADLIAGVIAGREKKRSVWLEVQSSLSSFILNSEVEVMKVIELSYDHLPHHLKPCLLHFASWPKDTPLTIYLLTVYLGAEGFVEKTEMKGIEEVVKIYMDDLISSSLVICFNEIGDILNFQIHDLVHDFCLIKARKENLFDRIRSSAPSDLLPRQITIDYDEEEEHFGLNFVMFDSNKKRHSGKHLYSLRINGDQLDDSVSDAFHLRHLRLIRVLDLEPSLIMVNDSLLNEICMLNHLRYLRIRTQVKYLPFSFSNLWNLESLFVSNKGSILVLLPRILDLVKLRVLSVGACSFFDMDADESILIAKDTKLENLRILGELLISYSKDTMNIFKRFPNLQVLQFELKESWDYSTEQHWFPKLDCLTELETLCVGFKSSNTNHCGSSVATNRPWDFHFPSNLKELLLYDFPLTSDSLSTIARLPNLENLSLYDTIIQGEEWNMGEEDTFENLKFLNLRLLTLSKWEVGEESFPNLEKLKLQECGKLEEIPPSFGDIYSLKFIKIVKSPQLEDSALKIKKYAEDMRGGNELQILGQKNIPLFK





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox