PRGWK00002484 (Ma)

From PRG Wiki
Jump to: navigation, search


Ma
Author User:Felice
Synonyms nematode resistance-like protein
Gene Type Contributed R-Genes
GenBank ID CAR94514.1
GenBank Locus CAR94514
Gene Class Class:TNL
Organism Species:Prunus cerasifera
Description nematode resistance-like protein [Prunus cerasifera]

The Ma gene for complete-spectrum resistance to Meloidogyne spp. in Prunus is a TNL with a huge repeated C-terminal post-LRR region.

Approved Yes



CDS Sequence

ATGGCTGATCCCATGACCACCCAAACCTCCTCAGCTTTGCCTCCTCCTCCGACCCGCCCACTGGAATATGAGGTGTTCCTCAGTTTTCGAGGTTTTGACACTCGAAAAGGTTTTACTGACCATTTGTACAAGGCTTTGATTCGGAACGGAATCCACACTTTCAGGGATGATGAACAACTGAAGAGTGGAAAACCCATTTCGAAGGAACTCTTCAAAGCAATTGAAGAATCGAAAATTTCAGTCATCATTCTTTCGACAAACTATGCGACCTCCACATGGTGTCTGGATGAACTTGCGAAAATGGTCGAACTGGCAAACAATGAGTCCAGATCGATTTTGCCCGTGTTCTACAACGTGACGCCATCTGAAGTACGAGAGCAAACTGGAGATCATTTTCAAGAGGCATTTGCTCAACATGATAAAGATTTCGAAGGTGAGCCAGGAAAGGTGGCAAGGTGGAAGAACTCTCTCACTGCAATAGCCGAACTCGAAGCCGAAGGATTTGATCTGACAAATTTTAGATACGAGACAGATATGATTGAAAAGATAGTTGAACGTATTTTTGGTGTTTTGATTAAAACATTCTCAAATGATGATTTAAAGGACTTTGTTGGAATGGATCGTGTAAATGAAATTAAATCCAAAATGAGTTTGTGTATGGGTTCAGAAGAAGTTCGTGTAATAGGGATTTGTGGGATGCCAGGGATTGGTAAGAGTACTGTTGCAAAAGCTCTTTCTCAAAGAATTCACAGTCAATTTGATGCTATCAGTTTCATTTCTAAGGTTGGAGAGATATCTAAAAAAAAAGGCTTATTTCATATCAAAAAACAACTTTGTGATCACTTGTTGGATAAGAAAGTAACCACAAAGGATGTCGATGATGTGATATGTAAGAGATTGCGTGACAAACGGGTGCTTATAATTCTTGACAACGTGGATGAATTAGAACAAATAGAAGCTGTGGCTGGAAGTGACGGTGCAGGCTTATCCAATCGGTTTGGTAAGGGAAGTAGAATCATCGTAACCACAACAGATGAAAGGTTGTTGATAGATTATAACCCAGAAATATACACAATTGAGAAACTTACTCCGGATCAAGCTCTTCTTCTCTTCTGTCGGAAAGCCCTCAAAACAGACCATCCCACGGATGCTTTTAAGAAGTTGTCTAACGAATTTGTAGATTACATTGATGGTCATCCATTGGCTCTTGAAGTTTTTGGTCACTCATTATGGAAAAGAGAAGAAGATTATTGGTCTACCAAATTGAAGTCTTTAAAAGATAAAGGCTACTCTGGTGAGAAGAAAATTATTGGTGTTCTTAAAGCAAGTTTTGATGGATTAGAGAATCAAGAACAGCAGGACATGTTTCTGGACACTGCATGTTTCTTCAAAGGCGAGGATGTATGTCGTCTAGAAAAGATATTTGAAAGTTGTGGCTACTATCCAGGCATCAATATAACCATCCTTTGTGAGAAATCTTTAGTAAGCATCGTAGGGGGAAGATTGTGGATGCATGATTTACTACAGAAAATGGGCAGAGGACTTGTTCTAGGAGAATCCAAAAAGGAAGGAGAACGCAGCAGATTGTGGCATCATACAGATGCCCTTCCTGTACTGAAGAAAAACAAGGGGACAGATGCTGTCCAAGGTATTTTCCTAAGCTCGCCTCAGCCAGACAAAGTACACTTGAAGAAAGATCCATTCTCAAACATGGACAATCTAAGATTGTTGAAGATTTACAATGTGGAATTTTCTGGATCCCTTGAATATCTTTCAGATGAGTTAAGCTTATTGGAATGGCACAAATGTCCTTTAAAATCTCTGCCTTCAAGTTTCGAACCCGACAAACTTGTTGAACTGAACTTGTCTGAAAGCGAAATAGAGGAATTATGGGAGGAAATTGAGAGACCCTTGGAAAAGCTGGCGGTATTAAACCTTAGTGATTGTCAAAAGTTGATCAAGACCCCTGACTTCGACAAAGTCCCAAACCTTGAGCAGCTAATCCTTAAAGGTTGTACAAGCTTGTCTGCGGTTCCCGATGATATCAACTTGAGATCTCTCACAAATTTCATTCTTTCGGGATGTTCCAAACTCAAAAAGCTTCCAGAGATTGGGGAGGACATGAAACAATTAAGGAAGCTTCATTTAGATGGGACAGCAATAGAAGAGCTACCAACATCAATCAAGCATTTGACTGGCCTTATTCTGCTCAATCTTAGAGACTGCAAGAACCTTTTGAGTTTGCCGGACGTCATTTGTACTAGTTTGACATCACTTCAAATACTCAACGTCTCAGGTTGTTCCAATCTTAATGAGTTACCAGAAAATTTAGGGAGTTTAGAATGTCTACAGGAGCTCTATGCAAGCAGGACAGCTATACAAGAGCTACCAACATCAATCAAGCATTTGACTGACCTTACTCTGCTCAATCTCAGAGAATGCAAGAACCTTTTGACTCTGCCAGATGTCATTTGTACTAATTTGACATCACTTCAAATTCTCAACCTCTCAGGATGTTCGAATCTTAATGAGCTACCAGAGAACTTGGGGAGTTTAGAATGTTTACAGGAGCTATATGCTAGCGGGACTGCTATAAGCCAAATACCTGAAAGCATCTCTCAGCTTTCTCAGCTTGGAGAACTTGTTTTGGATGGTTGTAGCAAGCTTCAATCATTGCCACGACTTCCATTTAGTATAAGAGCTGTAAGTGTACATAATTGTCCTCTCCTGCAGGGAGCACATTCAAATAAAATAACAGTGTGGCCTTCAGCTGCTGCCGGATTTAGTTTTCTAAATCGCCAAAGACATGACGACATAGCTCAGGCATTTTGGTTACCTGATAAACATCTATTGTGGCCATTCTATCAAACATTCTTTGAGGATGCCATTCGGCGTGATGAAAGGTTTGAATATGGTTATCGATCGAATGAAATTCCAGCATGGTTGAGCCGTCGGAGTACTGAATCCACCATAACAATCCCGCTGCCTCATGATGTAGATGGTAAGAGTAAATGGATAAAACTTGCTCTGTGCTTTATTTGTGAAGCAGCCCAGAAGCATGATAGTTTGGAAGATGTACCAGAATTTGATGAGGAATTGGGATTAAAATTCACTCGCAATCACCGTATTGAACTCTGTACAACTGAAGATCCTCATGAACGTCTCCTTGCGCTTGATTACCGTGATTGCAATTTCGCTGGACCATTTATACATTGGTGCTTTATACCACAGAGTGACCTTGCAGAAAGTTCAAATAAACGCTTGATCCAAGCTACAATTACACCTGATAGCCCAGGGACAAGGGTTACAGGGTGCGGGGTGAGTCTCATATACTTGGAAGATGTGCCCAAATTTGTCCGGAAATTGAATAAACACTATAGTTATTGCTATCATGGCTATCAGCCTGAACAAGAAGAAGATGGTATGAGAAGTATTCTGTCGACAAGCGGGATTCAAACTGAACAAGAAGAAGTACAGGAACAAGAAACTACTACTTCAACCCGGATTGTAGGTCAATTGAGAAGAAACGTGGAGTCATTGCTTGAAAAACTATTTGAGGGATTACAGCAGGGCCTTCCGAATCTCTATGATTATGGTTTTATTTTTTGTCTACGAGAAAGATTACCGTGGTTTAGTGAACAAAGCAGTACGTCTTCATGCACAGTAAACTTACGTCTTCCTCCAAATCTGCACAACAATGAGAAATGGGCAGGACTTTCTCTCTACGTTGTCTGTGCTCTGCCTCCAGGACTTCCGCTTTTTCGCACTTTCTATGAGTGTCACTTGTATACACCTATTGAGGCTGTGGGCCATGAGCAACTGATGCATCGCCTAATGTTATCTTCCTCCTGGGATGACAATGTGGGGTCACATCGACTCCTCATTATTCATATACCACGAGTACGCTTTCCGGAACGTCTTAATCGCTGCCATTTCATTCAGGCTTTATTTGGATGTAGAACTCCAGGTGTGGAGGTTAAAATGTGTGGGATGCGTCTAGTATACAACCAAGATTTGAAAGGGTTGATCCAAACAATTTCCCATTGCACCAATGATCGGCCTGCTTACTACGGAACTGGTGATTTTACAGAAACCAAGAAATATAAGGGAATTAGTTTGGGAGCTACAAGTTTGCTAACGAATCTGGTTGAAGCAGCCAAATCCAGCGAGCACAGCTCTGTCAGCGAAGTTTGTCCTCCTTTCATGCCTATAGATTTCCGTCCAGAACCTTATTCTGCTGAGTACTCCCAACATGAAAGAAAAACAACACCAATTCATCCACTACAGTACTTTGGCAATGCCTTTTATCCTACCAACAAAATGAGCTCAGATCAGAATCAGCTCCTAGACTTTGAACAGGACTTGAAATATAATTCTTGTTTCCCTCCAAATGAGATTGTAGAGTGGTTCGGGCATCAAAGCAGTGGCCCCTCTGTAAAAATCCCTCTACCATCAAATCTATGTGAAGACACCAACTGGATAGGACTGGCTTTATGTGCATACTTTTCAGTCCTTGACCACTCAACTATTGACCTTGAGAATTTGAATCCTGAAATTTCTCACAACCTTACATGTCTATTGGAAACTGATGAAAGTTGTCTGGAATCCCTCCATGGCTATAGCACCAACAGTCAAGAATTCAAGTGGTTGTATCGTATGGGAGGATTCATTTGGCTGTCCTATATACCACGATGCTGGTTTTCAGATCAGTTGAAAGAACGAGGCCACCTGGAGGCTTCAATTGGAAGCGATCATGGAAGCTTGGGTGTGCATAGGTGTGGGCTTCGTCTTATATATCTGGAAGATGAGGAAGGGCTTAAGGAGACCATAATGCACTGCATGACCTCCTTGTCAGATATTAATCAAGGAAAAGATGAGCAATACCAGAACTGCGAGGCAGGATCATCTAGTATAACTGGCAGCAACATTGTAAATCCTGTAAATCCCCATCTTGAAAGATCAGAGGAGCCCAATGATAAGAAATGGAACTTTGGTTGTCACACTATGTATAATTCTTGTTTCCCTTCAAGCATCACTCTGGAGTGGTTTGGGGATCAAAGCAGTGGCTCCTCGATAAGAGTCCCACTACCACCACATTTATATAGAGCCACTAATTGGATAGGATTGGCTTTATGCACATCCTTTTCAATCGTGGATAATCCAACTGCTGACCTAGACAATTTGAATCCAGAAATTTCTCACCACTTAATATGTCACTTGGAGTCGGACAGAGGTACAATAGAACCTCTCCATGACTACTGCACCACCAACGAAGAATTCCAATGGTTGCCTTTTGGAGGATTCATTTGGGTATCCTACATACCACGAGCGTGGTTTTCAGATCAGTTGAATGAATGTGATGTCCTGGAGGCTTCATTTGCAAGCGATCATGAAGCATTTACTGTGCACGAGTGTGGGCTACGTCTTGTATATCAGCATGACGAGGAAGAGATTAAGCAGACCATATTGCACTATATGACGTCGTTGTCAGATAAGAAAGGAAAAAATAAGCAATGCCCCATGGGTGACACGGGATCATCTAGTAGGCCTAGCAGCTATATTGTGAAACCTCATCTCGAAAGATTAGGAAGGCCTAGTGATGAGAAATGGGACTTTGATCGTCACTCCATGTATAACTCATGTTTCCCTTCAAGCATAACTCTAGAGTGGTTCGGCCATCAAAGCAATGACTCCTCGGCAACAATCTCGCTACCACATAATCTAAACTTAGACAGCAATTGGATAGGATTAGCTGTATGTGCATACTTTTCAGTCCTGGAGCATCCAACTGTCGACATTGACAATTTGGATATTCCAGCAATTTCTCACCACCTTATATGTAATTTGGAATCAGATAGAGACAGTCTAGAATCTTTGCATGACTACTGCACCACAAAGGAAGAATTCCTATGGTTGCATCTCGGAGGATTCGTTTGGGTATCCTATATACCACGAGCGTGGTTTTCAGATCAGTTGAATGAATGCGGTGTACTAGAGGCTTCAATTGCAAGCGATCATGAGGCCTTTAGTGTGCAAAAGTGTGGGCTCCGTCTTGTATATCAGCATGATGAGGAAGAGTTTAAGCAGACCATATCTCGTTCTCAGATAAGAAAGGGAAAAATAAGCAACACCCTCACTGCCCGCTGA


Protein Sequences

MADPMTTQTSSALPPPPTRPLEYEVFLSFRGFDTRKGFTDHLYKALIRNGIHTFRDDEQLKSGKPISKELFKAIEESKISVIILSTNYATSTWCLDELAKMVELANNESRSILPVFYNVTPSEVREQTGDHFQEAFAQHDKDFEGEPGKVARWKNSLTAIAELEAEGFDLTNFRYETDMIEKIVERIFGVLIKTFSNDDLKDFVGMDRVNEIKSKMSLCMGSEEVRVIGICGMPGIGKSTVAKALSQRIHSQFDAISFISKVGEISKKKGLFHIKKQLCDHLLDKKVTTKDVDDVICKRLRDKRVLIILDNVDELEQIEAVAGSDGAGLSNRFGKGSRIIVTTTDERLLIDYNPEIYTIEKLTPDQALLLFCRKALKTDHPTDAFKKLSNEFVDYIDGHPLALEVFGHSLWKREEDYWSTKLKSLKDKGYSGEKKIIGVLKASFDGLENQEQQDMFLDTACFFKGEDVCRLEKIFESCGYYPGINITILCEKSLVSIVGGRLWMHDLLQKMGRGLVLGESKKEGERSRLWHHTDALPVLKKNKGTDAVQGIFLSSPQPDKVHLKKDPFSNMDNLRLLKIYNVEFSGSLEYLSDELSLLEWHKCPLKSLPSSFEPDKLVELNLSESEIEELWEEIERPLEKLAVLNLSDCQKLIKTPDFDKVPNLEQLILKGCTSLSAVPDDINLRSLTNFILSGCSKLKKLPEIGEDMKQLRKLHLDGTAIEELPTSIKHLTGLILLNLRDCKNLLSLPDVICTSLTSLQILNVSGCSNLNELPENLGSLECLQELYASRTAIQELPTSIKHLTDLTLLNLRECKNLLTLPDVICTNLTSLQILNLSGCSNLNELPENLGSLECLQELYASGTAISQIPESISQLSQLGELVLDGCSKLQSLPRLPFSIRAVSVHNCPLLQGAHSNKITVWPSAAAGFSFLNRQRHDDIAQAFWLPDKHLLWPFYQTFFEDAIRRDERFEYGYRSNEIPAWLSRRSTESTITIPLPHDVDGKSKWIKLALCFICEAAQKHDSLEDVPEFDEELGLKFTRNHRIELCTTEDPHERLLALDYRDCNFAGPFIHWCFIPQSDLAESSNKRLIQATITPDSPGTRVTGCGVSLIYLEDVPKFVRKLNKHYSYCYHGYQPEQEEDGMRSILSTSGIQTEQEEVQEQETTTSTRIVGQLRRNVESLLEKLFEGLQQGLPNLYDYGFIFCLRERLPWFSEQSSTSSCTVNLRLPPNLHNNEKWAGLSLYVVCALPPGLPLFRTFYECHLYTPIEAVGHEQLMHRLMLSSSWDDNVGSHRLLIIHIPRVRFPERLNRCHFIQALFGCRTPGVEVKMCGMRLVYNQDLKGLIQTISHCTNDRPAYYGTGDFTETKKYKGISLGATSLLTNLVEAAKSSEHSSVSEVCPPFMPIDFRPEPYSAEYSQHERKTTPIHPLQYFGNAFYPTNKMSSDQNQLLDFEQDLKYNSCFPPNEIVEWFGHQSSGPSVKIPLPSNLCEDTNWIGLALCAYFSVLDHSTIDLENLNPEISHNLTCLLETDESCLESLHGYSTNSQEFKWLYRMGGFIWLSYIPRCWFSDQLKERGHLEASIGSDHGSLGVHRCGLRLIYLEDEEGLKETIMHCMTSLSDINQGKDEQYQNCEAGSSSITGSNIVNPVNPHLERSEEPNDKKWNFGCHTMYNSCFPSSITLEWFGDQSSGSSIRVPLPPHLYRATNWIGLALCTSFSIVDNPTADLDNLNPEISHHLICHLESDRGTIEPLHDYCTTNEEFQWLPFGGFIWVSYIPRAWFSDQLNECDVLEASFASDHEAFTVHECGLRLVYQHDEEEIKQTILHYMTSLSDKKGKNKQCPMGDTGSSSRPSSYIVKPHLERLGRPSDEKWDFDRHSMYNSCFPSSITLEWFGHQSNDSSATISLPHNLNLDSNWIGLAVCAYFSVLEHPTVDIDNLDIPAISHHLICNLESDRDSLESLHDYCTTKEEFLWLHLGGFVWVSYIPRAWFSDQLNECGVLEASIASDHEAFSVQKCGLRLVYQHDEEEFKQTISRSQIRKGKISNTLTAR





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox