PRGWK00002514 (RDC0002NLR0001)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0001
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS
Location Start 11914610
Location End 11914864
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGATTTCGAGAAGACTTTGTTATATGAAGTTGTTGATTGTGCTTGATGACATAGATTATGGTGATAATTAGGAGTAATTAGCAGGCGATCTTGGTTATTTCGTTTATGGAAACAGAGTTATTGTAACAATTAGAAATAGACATTTGATAGAACAGAATGATGCAATATATGAGTTTCCAACATTGCCTGATGATGACACTATGCAATTTTTCAATAAGCATTCTTATAAAATGAATTTAAAGATGAGCATTTAA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox