PRGWK00002515 (RDC0002NLR0002)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0002
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS
Location Start 52340687
Location End 52341355
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGTTGGGATTCTTTGGAGTCACCTAAGAACAAATTTCGCAACTCAATAGGCATGTTATGAGAAGTTAGCCTAATTAATCCATTATTACAACAAAAATCTGGTGATTCATATTGAAACCTTTTTGCTACACAAAATTTGCAATTAACGGCTGAGGAAAATACTATTGTTGGGATGGAGGACGACTTCAACATCATACTTGATCGTCTCATTTCACAAGCAGATGAGTTAACTGTCATACCAATTTTCGGTATGGCGGTATAGGTAAGACAACTCTTGCCAGGAAACTTTATGATAATTATTCTATTTGTTGTCGATTTGATAAACACGCATGGGTCACTATCTCTGAAAAATACAATGAGAGACAAATGCTTCTTAAAATTTTTTCTTTGATTACTAGAAATGATCGAGAAATGAGTAATGATCAACTAATGGAGACTGTGTATAGAGGTCTTAAGGGTAGGAGATTTCTAATTGTCATAGATGATATTTGGAGTACCGAGGCATGGGACCAAATGCAAAGAATATTTCCAAATGATGACAATAGAAGTCGAATTCTATTAACCACTCGCCTTACGTATGTTGCTAATTATGTCAGTTGTCCTGATTTTCCGCCTCATAGTAAATCTTTTCTAAGTCTAGAAGATAGTTGGTGTCTATTCACCGAATAA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox