PRGWK00002520 (RDC0002NLR0007)

From PRG Wiki
Jump to: navigation, search


RDC0002NLR0007
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:TIR, Domain:NBS, Domain:LRR
Location Start 83339739
Location End 83343353
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGTGTATAATTGTATTCTCACAAAATTATGCATCTCCTAGTTGGTGCTTGGATCAACTTGTTTCCATTCTTGAATACAAAATGAAGTTTGCATGTATGATATTGCCTATTTTCTACCATGTTGATCCTTCAAATCTGAGGAAGCACAAAGGAAGTTTTGGTGAAGCATTAAACAGACATGAAGAAAAATTCAAGTGTGAAAGAGTAGATGAAAAAGAGTATTGGGAGGACAAGTTAAAAAAATGGAAAGATGCACTGAGCCAAGCTGCTGATTTGGCTGGAATGGTCCTTGAAAATCAGTAAGTTATATTTATTCATGTATCGTCGATGTAACAAATTTTTGCGGGTTAATAGCAGGTAACCTGTCTTATTTTCAAGATTATAAAATCTCGAAAATCTTAAGGAGTGTTCTTTATTTTTCAGGCATGAATCCACTTTCATCAAGAAGGTTATTAACGTTATCAGCACGAGACTAAGTCGTCCTGCTTTATATATTGCTTCTTGTTCAATCGGAATACATCGTAGAGCTAGGCCTATTAATTCTTGGGTTCAAGATGATGGATCGAACAATTCAAATATTGGAATACTTCTAGTTTGTGGTATTGGTGGAATTGGAAAAACAACACTTGCCAAATTTGTTTACAATTTAAACTTTGGATATTTTGAAATTAGTTGTTTCTTACCAAATATTAGAGAAACATCAAAACTCCCTAATGGTCTCATAGCTTTACAAAAGCAACTACTTTCTATCCTTTTAAAGAATGAAAAGGCAAAAATATCAAGTGTTGATGAAGGAATCATCAAGATAAGAAATGCTTTATGTTATCGAAAAGTTCTTCTTGTTCTTGATGATGTTGATGAGCCTGATTTGGTTGAAGCAATATTTGACATGAAAGATTGGTTTGGATTTGGAAGTAAAATAATTGTAACAACTAGGCACAAAAGTTTATTAAGACCTCAATTAGGCCATGAGGTACATGAAGTTGGAATTTTGTACACAATTGAAGCAAATGAGCTCTACAATTTTCATGCATTTGGTAATGTAAACAATCAAATAAGCAAAGATTATTACAAAGAGTACTTAGAGGAAGTAATTGAATGGTGTAGAGGACTTCCATTAGCTCTTCAAGTTATCGGTTCTTCCTGTTGGGTTTTAGTAAGTGTGAATGGGAAAAGAAAAGAGACAATATGAAAAGTGAGGGAACTACTTTGGAGGAAAAATGAAAAGTCATTTGCAAAATGCAAATGAAAAGTCATTTCTCCCATATCGGCAAAAGAAATGGAAATTGTCCTTATAGAAGGAAACACTTCCATTACTTCTTAAAAGAGATAAGAAGATGTCACTCGCGCCGTCGCTCGGCTTTGGATTTGATTGATAAATTTTTTGCACAAAATTTATTTAATCAGTTTTTGTTAATATTATCTCTTATAAATTTGTGGGTAACGGTAACATTTCGAAAAGTTGTTACTTTTCCGAAAAGTTGGGTCTGAACAGATTTCACTGAACAGACATGTTCTTTGCTGAAAATGGCTATAAAAGGAAGTCAATTTTTTATTTTTCAAACACTGAAAATTTTTCTTTCTCTGCATTTATTTTTCTCTCAAATAAAAATCAAAGTGTCGATCGACTGAGTCTGTGTGACTTGTTGATGTTCTTAAGTTCGCTGAAGTTAAAGAAATTTGAGGTACTGCTATTTCTTTAACAGGTTTAATCCGTTTTATCTTGGGAGAAATTAATCCATAACCTTGGGTACAGTGAGGGAATTAAATTTCTTAAGGACTCGGATTATTTCTTGTATTTTATATTTTTTTTGCTTCATCTTATTTCTGTTTCTGTTTATTAACCTTATAAATACAGGTTATTGTAAGTATAACAATCTTACAACACTTCCATAGCTGGAAAATCAAAAGATGTATGGAGAAGTGCTATAGGAAAGTTGAGAGAAATTCCGACAAATGAAATTGTTGAGAAATTGAGATTGAGTTATGAGTTATTGGAAGATGATCATGATCAGAATTTGTTCCTTCATCTTTGTTGTTTCTTTGTGGGGATGAAAAAAGATTTTGTAGTTAGGATATTAGATAAATGTGATTTTTACACATTGGTTGGGATACAAAATCTAATTGATAGAAGTTTAGTGACAATTGAATTTGTGAATGAGATAACAATACATCAATATGGGAAGAGATATTGTTCGTAGAGAAGCAACTGTGGATCCTGGAAAACGTACTAGGCTTTGGCATCACACAGATTCTTACAATGTTCTAACAGGAAAAACAGTAAGTAATTAATCATGTTCCTAATTTTTAATATTTTGGTCATCGTCGTTATAAAAGTAGCTCATTACTGTATTTTATTTTTCTTGTGATTTATATTAGGGAACAGAGAGAGTGCAGGGGATGGTACTTGACATGCGTATGATTAAGAAATACAAGTGTTCTGGGTCCTTAATACCATTGAAACAAAGTCCAATTGGTTTTTTCACAGCTTGGAGTTCAAAAGTGGGGAATTTTAGTTTACAAGATCATGTGAGAACTGATGCCTTTGAGAAAATGCACAAGCTTAAATTTCTCCAATTCAACAAAGTTAAAGTGAATGGAAGTTACAAGAACTTTCCAAAGGGATTGAGATGGCTATGTTGGAGTGGATTCCCAGAGGAGTGTATACCAAATGAGTTTCCAATGGGAAATGTCGTTTCTATCGATATGCGATACAGCTGCTTGAAACAACTTTGGAACGGATATAAGGTAATTAATTTTCTTTCATCCTCAGTTGGGTGTCAAAAGTTAACACGAGTTGAACCATTGCATCAGTTTATAAGCCTCTTGAATTGGCCTAATCTTTTGAAATGGGCTTCTTATCCAGTGTATATTACTTATACTACGACTTTTATCAAACAAATGACTTAATTTTCTTTGTTTTGATGCATTAGTTTCTCCGGTACCTAGAGATACTGGATTTGAGCCACTCCACTGAACTCATCACAACACCGGATTTCTCAGGCCTTACCAATCTTGAAAAGTTGATACTCGAACAATGTACAAAGTTAATCAATGTTCATAACACCGTTGGATGTCTACAAAAACTCATGATCTTGAACCTTAAAGATTGCCACAAGTTAAAGATTCTTCCAGATAGCATTTGTGAGTTAAAATGTCTTGAGACACTTAACATCTCAGGCTGCTCAAACATTGAATATTTACCAACAGAGCTTGATAAATTAACATCACTAAAGGAACTTTATGCTGATGGGATCTCAATGATTAATTTGGAGGCCCAAACATGGTATTCATCTTTGTGGGCTTGGGCCTGGAAAGGAAGAGGCCCATTATTATCTCCTAAAATTCATTTTCCCAAGTCCTTACATGTGTTAAACATTGCAAAATGCAATTTATCTCCAGATGCTTGATTTAGGCATTATGACCTCACTACAATGGCTAGATTTGGGAGGAAATCCGATTGACGAATTACCAGATAGTATCAAGAATCTTACGAGGCTGAAAACTCTTAACATCGCGTGTTGTACAAAGATCAAGTACCTCGAAGGGGTACCATCAAATGTAACGGATGTAAATGCTGATGGATGTATTGGAGAAAGTAGGTTCTTGTGCTAA

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox